Targeting the OTUD4-USP7 complex represses KSHV lytic replication

Given our findings that OTUD4 recruits USP7 to promote the deubiquitylation and stabilization of RTA, facilitating KSHV lytic replication [27], we hypothesized that disrupting the interaction between OTUD4 and USP7 might inhibit KSHV lytic replication. To test this hypothesis, we aimed to design a peptide to block the interaction between OTUD4 and USP7, thereby promoting RTA degradation to curb KSHV lytic replication. Our previous studies have revealed that the TRAF domain of USP7, rather than the catalytic domain (CD) or the tandem ubiquitin-like domain (UBL) domain, binds to the N-terminal region of OTUD4 [27]. Based on the consensus P/A/ExxS recognizing sequence of the USP7 TRAF domain [28], we synthesized a series of peptides derived from sequences within the N-terminal region of OTUD4 that may involve in USP7 binding. These peptides, designated p1 to p12 (Figs 1A and S1A), were analyzed for the ability to bind the USP7-TRAF domain. Surface plasmon resonance (SPR) analysis revealed that two peptides, p2 and p8, specifically bound to the USP7-TRAF domain, with dissociation constants (K_D) of 9.02 μM and 3.16 μM, respectively (Fig 1B). To assess the antiviral activities of these peptides, we conjugated the peptides with the cell-penetrating peptide (CPP) Tat to facilitate cellular intake [29]. Interestingly, we found that p8 effectively inhibited KSHV lytic reactivation in a dose-dependent manner, whereas the control pGFP peptide and p2 showed no significant inhibition (Figs 1C and 1D, and S1B and S1C Figs). Further analysis revealed that p8 inhibited KSHV lytic reactivation with an IC₅₀ of 52.64±8.49 μM, while IC₅₀ for p2 could not be determined due to its low antiviral activity (Fig 1E and S1D Fig). Moreover, p8 treatment did not affect KSHV latent gene transcription or genome replication, indicating that p8 does not impact viral latency (S1E and S1F Fig). Additionally, we assessed the cytotoxicity of p8 and found that it exhibited minimal cytotoxicity on the cells (Fig 1F). Collectively, these data indicate that the rationally designed OTUD4-derived peptide p8, which binds to USP7, shows promising antiviral activity against KSHV lytic replication.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Rationally designed peptide p8 demonstrates anti-KSHV activity.

(A) Graphical illustration showing the rationale underlying our peptide design. (B) Surface Plasmon Resonance (SPR) analysis assessing the interaction of the USP7-TRAF domain with the designed peptides p2 and p8. (C) SLK.iBAC-GFP cells were induced with doxycycline (Dox, 1 μg/mL) and sodium butyrate (0.5 mM) in the presence of the Tat fusion peptides (100 μM). All the peptides were fused to an N-terminal Tat_47-57 peptide (YGRKKRRQRRR) via a flexible GG linker. The supernatants containing infectious virions were collected 48 h post-induction and used to infect HEK293T cells. KSHV infectious units were calculated based on the percentage of GFP-positive cells determined by flow cytometry. Data are mean ± s.d. of N = 3 independent biological replicates. (D) SLK.iBAC-GFP cells were induced with doxycycline (Dox, 1 μg/mL) and sodium butyrate (0.5 mM) in the presence of increasing amount of p8 (0, 10, 50, 100 μM). KSHV infectious units were determined 48 h post-induction. Data are mean ± s.d. of N = 3 independent biological replicates. (E) Comparative inhibitory activity of pGFP and p8 against KSHV lytic reactivation in SLK.iBAC-GFP cells. Data are mean ± s.d. of N = 3 independent biological replicates. (F) SLK.iBAC-GFP cells induced with Dox (1 μg/mL) and sodium butyrate (0.5 mM) were mock-treated or treated with pGFP, or p8 (100 μM). Cell viability was assessed by measuring ATP levels 48 h post-induction. Data are mean ± s.d. of N = 3 independent biological replicates.

https://doi.org/10.1371/journal.ppat.1013052.g001

P8 Disrupts the USP7-OTUD4 complex

Our studies thus far suggest that p8 disrupts the USP7-OTUD4 complex to repress KSHV lytic replication. To elucidate the mechanism by which p8 interferes the interaction between OTUD4 and USP7, we first utilized AlphaFold3 to predict the complex structure of the USP7-TRAF domain with p8 [30], given the availability of numerous crystal structures of the USP7-TRAF domain [31–36]. The overall structure of USP7-TRAF adopts a typical eight-stranded antiparallel β-sandwich configuration, forming a shallow groove on its surface (Fig 2A). The binding of p8 to USP7-TRAF is primarily mediated by a combination of hydrophilic and hydrophobic interactions with the β7 strand of USP7-TRAF, which contains a β-bulge structure (Fig 2B). Notably, nine hydrogen bonds are formed between p8 and the β7 strand of USP7-TRAF, five of which involve the Asp164 and Trp165 residues of USP7-TRAF (Fig 2B). Crucially, the key residue Ser8 of p8 forms hydrogen bonds and van der Waals interactions with Asp164 and Trp165 of USP7-TRAF, thereby dominating the binding interface (Fig 2C). And importantly, Ser8 confers a structural conformation on p8 that facilitates its optimal binding with USP7-TRAF, enabling the formation of a stable complex (Fig 2C). When Ser8 of p8 is mutated to Alanine (p8m), no interaction with USP7-TRAF is observed within 0.3 Å with AlphaFold3 prediction, in contrast to the strong interaction with the original p8 (Fig 2D).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. P8, but not the p8m mutant peptide, disrupts the USP7-OTUD4 complex and represses KSHV lytic reactivation.

(A) Transparent surface representation of the USP7-TRAF domain (residues 53–208, plum) bound to peptide p8 (green) predicted by AlphaFold3. (B-C) Detailed interaction between USP7-TRAF (plum) and p8 (green) based on AlphaFold3. The H-bonds are indicated by dashed lines. (D) Structural overlay of USP7-TRAF (plum), p8 (green), and the p8m mutant peptide (orange) derived from AlphaFold3 prediction. The overall structure of USP7-TRAF bound to either p8 or p8m was shown in a transparent surface diagram (left), with detailed interaction sites highlighted on the right. The H-bonds are indicated by dashed lines. (E) Bacterially purified GST or GST fusion proteins (GST-USP7-TRAF WT, D164A or W165A) were incubated with FLAG-OTUD4 expressed in HEK293T cells for 4 h. Coomassie blue staining was used to visualize GST-tagged proteins, while western blotting was employed to detect FLAG-OTUD4. Densitometry analysis of the bands was performed using ImageJ. (F) Bacterially purified GST or GST-USP7-TRAF proteins were incubated with FLAG-OTUD4 expressed in HEK293T cells in the presence of the peptides [pGFP, p8, and p8m (100 μM)] for 4 h. Coomassie blue staining was used to visualize GST-tagged proteins, while western blotting was employed to detect FLAG-OTUD4. Densitometry analysis of the bands was performed using ImageJ. (G) FLAG-OTUD4-expressing SLK.iBAC-GFP stable cell lines were induced with Dox (1 μg/mL) and sodium butyrate (0.5 mM) to initiate lytic reactivation in the presence of pGFP or p8 peptides (100 μM). The cells were fixed and subjected to Proximity Ligation Assay (PLA) with FLAG and USP7 antibodies 24 h post-induction. Representative images (scale bars, 10 μm), and quantitative analysis of PLA puncta per cell were shown (Data are mean ± s.d. of N = 54 independent biological replicates for the pGFP group, and N = 58 independent biological replicates for the p8 group). (H-J) BCBL-1-Tet-K-RTA cells were induced with Dox (1 µg/mL) and sodium butyrate (0.5 mM) in the presence of the indicated peptides (100 µM). KSHV genome copies in the supernatants were quantified by qPCR 48 h post-induction (H), and viral gene expression and protein levels were analyzed by RT-qPCR (I) and immunoblotting (J). Data are mean ± s.d. of N = 3 independent biological replicates (H and I). Densitometry analysis of the bands was performed using ImageJ (J).

https://doi.org/10.1371/journal.ppat.1013052.g002

To validate the structural predictions, we generated point mutations of the key residues in both USP7-TRAF and p8. Specifically, mutation of Asp 164 or Trp165 in USP7-TRAF to Alanine significantly reduced OTUD4 binding in GST pull-down assays, confirming that Asp164 and Trp165 are critical for the interaction between OTUD4 and USP7-TRAF (Fig 2E). Moreover, while p8 effectively blocked the interaction between OTUD4 and USP7-TRAF, the p8m mutant (S8A) failed to do so (Fig 2F). Additionally, p2 fails to disrupt the interaction between USP7-TRAF and OTUD4 (S2A Fig). Next, we employed proximity ligation assay (PLA) to examine the impact of p8 on the interaction between OTUD4 and USP7 during viral infection. Since commercial OTUD4 antibodies failed to produce reliable immunofluorescence signals, we generated a FLAG-OTUD4 stable cell line. PLA results indicated that p8 treatment disrupted the co-localization of OTUD4 and USP7 (Fig 2G). Next, we selected several known substrates of USP7 (MDM2, p53 or ICP0) [37] to evaluate the specificity of p8. Our results indicate that p8 did not affect the interactions between USP7 and MDM2, p53, or ICP0 (S2B-S2D Figs), suggesting that p8 specifically disrupts the interaction between OTUD4 and USP7. These findings indicate that OTUD4 interacts with USP7 via the Asp164 and Trp165 residues of the USP7-TRAF domain, and that p8 disrupted the OTUD4-USP7 complex by specifically targeting the binding interface between OTUD4 and USP7.

P8, but not the p8m mutant peptide, represses KSHV lytic reactivation

Our previous study revealed that KSHV hijacks the OTUD4-USP7 complex to facilitate lytic reactivation [27]. Therefore, we hypothesize that disrupting the interaction between OTUD4 and USP7 would repress KSHV lytic reactivation. Indeed, treatment with the p8 peptide, but not p8m, significantly reduced KSHV progeny virion production (S2E Fig), and decreased the transcription levels of multiple viral genes, including immediate-early gene ORF50, early genes ORF56 and ORF57, and late genes ORF25 and ORF26 (S2F Fig). Additionally, protein levels of RTA, ORF45, K8α, and ORF57 were also diminished following p8 treatment (S2G Fig). To further validate the function of p8 in repressing KSHV lytic reactivation, we utilized the BCBL-1-Tet-K-RTA cell line, a human primary effusion lymphoma (PEL) cell line that undergoes lytic reactivation upon doxycycline induction [38]. We confirmed that p8 significantly impaired KSHV lytic replication, demonstrated by reduced progeny viral genomic copy number, decreased transcription of KSHV lytic genes, and lower levels of viral proteins upon p8 treatment (Figs 2H-2J). These data collectively indicate that p8 represses KSHV lytic reactivation.

P8 inhibits KSHV lytic reactivation by targeting the RTA-OTUD4-USP7 complex

Given that p8 specifically disrupts the interaction between OTUD4 and USP7, and that the OTUD4-USP7 complex is critical for maintaining RTA stability [27], we hypothesized that p8 treatment promotes RTA degradation to repress KSHV lytic replication. Indeed, p8, but not the p8m mutant peptide, reduced the protein level of RTA in iSLK cells, a doxycycline-inducible K-RTA cell line [39] (Fig 3A). Additionally, while OTUD4 expression enhanced the protein level of RTA, p8, but not p8m, countered the promoting effect (S3A Fig). Consistently, p8, but not p8m, efficiently suppressed KSHV lytic reactivation. However, the antiviral effect of p8 was abolished in OTUD4-deficient or USP7-deficient cells (Figs 3B and S3B). Furthermore, OTUD4 expression promoted KSHV lytic replication, which can be negated by p8 but not p8m (Fig 3C). There data indicate that the antiviral activity of p8 against KSHV relies on the OTUD4-USP7 complex.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. P8 inhibits KSHV lytic replication by targeting the RTA-OTUD4-USP7 complex.

(A) iSLK cells were induced with Dox (1 µg/mL) in the presence of indicated peptide (100 µM). WCLs were analyzed by immunoblotting 48 h post-induction. Densitometry analysis of the bands was performed with ImageJ. (B) SLK.iBAC-GFP cells transduced with control shRNA, shRNA targeting OTUD4, or USP7 were induced with Dox (1 µg/mL) and sodium butyrate (0.5 mM) in the presence of the indicated peptide (100 µM). KSHV infectious units were quantified 48 h post-induction. Data are mean ± s.d. of N = 3 independent biological replicates. (C) SLK.iBAC-GFP cells stably transduced with vector control or OTUD4 were induced with Dox (1 µg/mL) and sodium butyrate (0.5 mM) in the presence of the indicated peptide (100 µM). KSHV infectious units were quantified 48 h post-induction. Data are mean ± s.d. of N = 3 independent biological replicates. (D) SLK.iBAC-K-RTA-WT or SLK.iBAC-K-RTA-F689A/R690A/D691A (3A) cells were induced with Dox (1 µg/mL) and sodium butyrate (0.5 mM) in the presence of the indicated peptide (100 µM). KSHV infectious units were quantified 48 h post-induction. Data are mean ± s.d. of N = 3 independent biological replicates. (E) SLK.iBAC-GFP cells were induced with Dox (1 µg/mL) and sodium butyrate (0.5 mM) in the presence of the indicated peptide (100 µM). Cell viability was assessed by measuring ATP levels 48 h post-induction. Data are mean ± s.d. of N = 3 independent biological replicates.

https://doi.org/10.1371/journal.ppat.1013052.g003

Previously, we identified the C-terminal FRD motif of RTA as crucial for recruiting the OTUD4-USP7 complex, and generated a KSHV-RTA-3A mutant by introducing F689A/R690A/D691A triple mutations into KSHV genome [27]. Since the RTA-3A mutant was unable to recruit OTUD4-USP7 to stabilize RTA, KSHV-RTA-3A demonstrates severe impaired lytic reactivation [27]. Remarkably, unlike KSHV-RTA-WT, p8 failed to suppress lytic reactivation of KSHV-RTA-3A (Fig 3D). Additionally, we assessed the cytotoxicity of p8 and p8m and found that they exhibited minimal cytotoxicity on the cells (Fig 3E). These data indicate that p8 reduces RTA level by disrupting the interaction between OTUD4 and USP7, thereby repressing KSHV lytic reactivation.

OTUD4 deficiency impairs MHV68 replication

Previously, we discovered that OTUD4 plays a critical role in KSHV lytic reactivation [27]. Next, we asked whether OTUD4 also promotes the replication of MHV68, a murine herpesvirus that is genetically and biologically relevant to KSHV. Knockdown of OTUD4 in NIH3T3 cells significantly impaired MHV68 lytic replication, as indicated by the decreased GFP intensity (S4A and S4B Fig). Consistently, the infectious progeny virus titers were dramatically reduced in the OTUD4-depleted cells (S4C Fig). These data indicate that OTUD4 promotes MHV68 replication.

To explore whether OTUD4 has a critical role in herpesvirus replication in vivo, we turned to MHV68 for in vivo infection studies in mice, since KSHV exhibits strict host tropism and primarily infects humans as the only natural host [40–42]. MHV68 readily infects laboratory mice, leading to acute replication lasting around two weeks, and then establishes latency primarily within B-lymphocytes, providing a useful model for studying herpesvirus replication in vivo [43]. We generated Otud4^fl/fl mice and crossed them with ROSA26-CreERT2 mice to obtain Otud4^fl/fl Cre-ERT2^+/- and Otud4^fl/fl Cre-ERT2^-/- mice. Then, we generated primary mouse lung fibroblasts (MLFs) from these mice, and induced OTUD4 knockout with 4-hydroxytamoxifen, and then performed MHV68 infection ex vivo (Fig 4A). Consistent with our previous findings [27], MHV68 replication was significantly reduced in OTUD4 knockout MLFs compared to control cells, as indicated by reduced GFP intensity and progeny virus production (Fig 4B and 4C). Additionally, the transcription levels of the viral genes (ORF50, ORF9, and ORF25) were greatly decreased in OTUD4-depleted cells (Fig 4D). To further confirm the role of OTUD4 in MHV68 replication, we performed rescue experiments. We reconstituted OTUD4-deficient MLF cells with an OTUD4 construct, a DUB-deficient C45A mutant, or a DUB deletion mutant (ΔDUB) (S4D Fig). While OTUD4 knockout markedly reduced MHV68 progeny viral titer, reconstitution of OTUD4 reversed the effect of OTUD4 deficiency on MHV68 replication (Fig 4E). Notably, the DUB-deficient mutants (C45A and ΔDUB) also effectively rescued MHV68 replication (Fig 4E), indicating that OTUD4 promotes MHV68 lytic replication independently of its DUB activity.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. OTUD4 deficiency impairs MHV68 replication in vivo.

(A) MLFs derived from Otud4^fl/fl Cre-ERT2^-/- and Otud4^fl/fl Cre-ERT2^+/-mice were treated with 4-hydroxytamoxifen (1 μM) for 3 days to generate OTUD4 knockout cells. Whole-cell lysates (WCLs) were prepared and analyzed by immunoblotting. (B) MLF cells described in Fig 4A were infected with MHV68-GFP (MOI, 0.01). The supernatants containing infectious virions were collected 48 h post-infection and used to infect BHK21 cells. GFP expression was imaged 48 h post-infection. Scale bars, 100 μm. (C) OTUD4 knockout MLFs described in Fig 4A were infected with MHV68 (MOI, 0.01), and viral titer was determined at the indicated time points post-infection. Data are mean ± s.d. of N = 3 independent biological replicates. (D) OTUD4 knockout MLFs described in Fig 4A were infected with MHV68 (MOI, 0.01), and viral gene expression was quantified by RT-qPCR 48 h post-infection. Data are mean ± s.d. of N = 3 independent biological replicates. (E) OTUD4 knockout MLFs reconstituted with control vector, OTUD4, OTUD4-C45A, or OTUD4-ΔDUB were infected with MHV68-GFP (MOI, 0.01). MHV68 viral titer was quantified 48 h post-infection. Data are mean ± s.d. of N = 3 independent biological replicates. (F) Otud4^fl/fl Cre-ERT2^-/- and Otud4^fl/fl Cre-ERT2^+/- mice were intraperitoneally injected with tamoxifen for five consecutive days. The protein levels of OTUD4 in the lungs were analyzed by immunoblotting. (G-I) Otud4^fl/fl Cre-ERT2^-/- and Otud4^fl/fl Cre-ERT2^+/- mice described in Fig 4F were intranasally infected with MHV68 (4000 PFU). Viral gene expression (G) and viral titer in the lungs (H) were quantified 5 days post-infection, and mouse lung tissues were processed with H&E staining (I). Scale bars, 500 μm (left) and 100 μm (right). Data are mean ± s.d. of N = 5 independent biological replicates (G and H).

https://doi.org/10.1371/journal.ppat.1013052.g004

To investigate OTUD4’s role in MHV68 replication in vivo, we administered tamoxifen to Otud4^fl/fl Cre-ERT2^+/- and Otud4^fl/fl Cre-ERT2^-/- mice to induce OTUD4 knockout, followed by MHV68 infection via intranasal inoculation. As expected, tamoxifen treatment depleted OTUD4 in the lungs of Otud4^fl/fl Cre-ERT2^+/- mice but not in Otud4^fl/fl Cre-ERT2^-/- mice (Fig 4F). OTUD4 deficiency significantly reduced MHV68 viral titers in lung tissues (Fig 4G). Consistently, the transcription levels of multiple viral genes (ORF50, ORF9, and ORF25) were markedly decreased in the lungs of OTUD4-deficient mice compared to control mice (Fig 4H). Additionally, OTUD4-deficient mice exhibited less inflammation and immune cell infiltration in the lungs after MHV68 infection compared to control mice (Fig 4I). Collectively, these data indicate that OTUD4 deficiency impairs MHV68 lytic replication in vivo.

Our previous study revealed that OTUD4 promotes the deubiquitination of RTA protein to enhance its stability, thereby facilitating KSHV lytic reactivation [27]. Given that MHV68 is genetically and biologically closely related to KSHV, we hypothesized that OTUD4 might promote MHV68 lytic replication through a similar mechanism. Indeed, ectopic expression of wild type (WT) mOTUD4 (murine OTUD4), the C45A DUB-deficient mutant, or the ΔDUB mutant enhanced m-RTA (MHV68-RTA) protein levels (S4E Fig), consistent with our observations that the DUB activity of OTUD4 is not required for promoting MHV68 lytic replication (Fig 4E). Furthermore, human OTUD4 WT or the C45A mutant also increased m-RTA expression in a dose-dependent manner (S4F Fig), suggest that the stabilization of RTA by OTUD4 is a conserved strategy among different species. Additionally, mOTUD4 WT, as well as the C45A and ΔDUB mutants, promoted the deubiquitination of m-RTA (S4G Fig). These data indicate that OTUD4 stabilizes m-RTA and promotes MHV68 replication, and suggest that the stabilization of RTA proteins by OTUD4 is a conserved strategy among gamma-herpesviruses.

P8-DRI restricts MHV68 infection in vivo

Given that OTUD4 has a critical role in MHV68 replication and that MHV68 is genetically and biologically related to KSHV, we next assessed the antiviral activity of p8 against MHV68 in vivo. First, we performed sequence alignment of human and murine USP7 and OTUD4. USP7 is evolutionarily conserved, and sequence alignment of human and murine USP7-TRAF domains revealed >95% identity. Sequence alignment of the N-terminal regions of human and murine OTUD4, which is responsible for USP7-TRAF binding, also revealed high similarity (>85%) (S5A Fig). However, there are three amino acid differences between p8-m (murine-derived p8) and p8 (human-derived p8). To evaluate the binding, using AlphaFold3, we predicted the structure of the p8 -murine USP7-TRAF complex. The binding mode exhibited structural congruence with human USP7-TRAF, suggesting that p8 can target both human and murine USP7-TRAF (S5B Fig). Similarly, AlphaFold3 structural prediction of the p8-m-murine USP7-TRAF complex revealed that binding is partly mediated by interactions between the N8 residue of p8-m and D165 and W166 of murine USP7-TRAF. Additionally, the Q7 and S9 residues of p8-m also contributes to the interaction (S5C Fig). However, unlike p8, the N-terminus of p8-m is partially solvent-exposed in the complex. Subsequent mutagenesis experiments indicated that alanine substitution of D165 and W166 in murine USP7-TRAF greatly impaired its interaction with mOTUD4, suggesting that the USP7-OTUD4 binding interface near the p8 region is conserved between human and murine (S5D Fig). In line with the structural predictions, both p8 and p8-m effectively disrupted the interaction between murine USP7-TRAF and murine OTUD4, while p8 showed slightly stronger inhibitory activity (S5E Fig). More importantly, we found that p8 demonstrated potent antiviral activity against MHV68 in both MLF and NIH3T3 cells, as evidenced by a significant reduction in viral gene expression. In contrast, a control peptide pGFP and the p8m mutant peptide had no inhibitory effects (Figs 5A, 5B, and S5F and S5G Figs). These data indicate that p8 also effectively represses MHV68 replication.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. P8-DRI restricts MHV68 Infection in vivo.

(A-B) MLF cells were infected with MHV68 (MOI, 0.01) and treated with the indicated peptides (100 µM). Viral titer was determined by plaque assays 48 h post-infection (A). Viral gene expression was assessed by RT-qPCR (B). Data are mean ± s.d. of N = 3 independent biological replicates. (C) Comparative inhibitory activity of pGFP and p8-DRI (nssqsasqnvpprrrqrrkkrGy) against KSHV lytic reactivation in SLK.iBAC-GFP cells. Data are mean ± s.d. of N = 3 independent biological replicates. (D-E) C57BL/6 mice were intranasally inoculated with MHV68 (4000 PFU) and administrated with p8-DRI (5 mg/kg of body weight) or vehicle control (n=6 per group). Viral loads in lung tissues were quantified at 5 days post-infection (D). Viral gene expression in lung tissues was measured by RT-qPCR at 5 days post-infection (E). Data are mean ± s.d. of N = 6 independent biological replicates. (F) H&E staining of lung tissue sections from MHV68-infected mice treated with p8-DRI or vehicle 5 days post-infection. Scale bars, 500 µm (left) and 100 µm (right). (G-H) Otud4^fl/fl Cre-ERT2^-/- and Otud4^fl/fl Cre-ERT2^+/- mice were administered with tamoxifen via intraperitoneal injection. After 5 days, the mice were intranasally infected with of MHV68 (4000 PFU) and treated with p8-DRI (5 mg/kg of body weight, n=4) or vehicle control (n=5). Viral titers in lung tissues were determined at 5 days post-infection (G). Viral gene expression in lung tissues was assessed by RT-qPCR (H). Data are mean ± s.d. of N = 5 independent biological replicates for the vehicle group, and N = 4 independent biological replicates for the p8-DRI group. (I) H&E staining of lung tissue sections from MHV68-infected Otud4^fl/fl Cre-ERT2-/- and Otud4^fl/fl Cre-ERT2^+/- mice treated with p8-DRI or vehicle control, analyzed at 5 days post-infection. Scale bars, 500 µm (left) and 100 µm (right). Histological evaluation and scoring of the lung tissues were performed by a blinded pathologist. Data are mean ± s.d. of N = 5 independent biological replicates.

https://doi.org/10.1371/journal.ppat.1013052.g005

Next, to improve the antiviral efficacy of p8, we modified it by replacing L-isomers with D-isomers and reversing the peptide sequence [44]. These DRI modifications are expected to improve peptide stability and antiviral potency, and have demonstrated excellent tolerance and therapeutic effectiveness [45–48]. As anticipated, the DRI-modified version of p8, referred to as p8-DRI, exhibited enhanced anti-KSHV activity, with an IC₅₀ of 9.23±1.29 μM (Fig 5C), significantly lower than the IC₅₀ of the original p8 (52.64±8.49 μM). Importantly, the binding affinity of p8-DRI for USP7-TRAF remained comparable to that of p8 (S5H Fig). In addition, our results revealed that the IC₅₀ for p2-DRI was 67.41± 34.09 μM, which correlates with its low antiviral activity. (S5I Fig).

To evaluate the antiviral efficacy of p8-DRI in vivo, we treated C57BL/6 mice with p8-DRI following intranasal infection with MHV68. Mice treated with p8-DRI showed lower viral titers in lung tissues compared to vehicle-treated controls (Fig 5D). Additionally, the transcription levels of multiple MHV68 viral genes (ORF50, ORF9, and ORF25) were significantly reduced in the lungs of p8-DRI-treated mice (Fig 5E). Moreover, p8-DRI-treated mice exhibited less inflammation and immune cell infiltration in the lungs after MHV68 infection compared to vehicle-treated control mice (Fig 5F). These data indicate that p8-DRI restricts MHV68 Infection in vivo. To investigate whether the in vivo antiviral activity of p8-DRI is dependent on OTUD4, we administered tamoxifen to Otud4^fl/fl Cre-ERT2^+/- and Otud4^fl/fl Cre-ERT2^-/- mice to induce OTUD4 knockout, followed by MHV68 infection and p8-DRI treatment. As expected, Otud4^fl/fl Cre-ERT2^-/- (OTUD4-replete) mice treated with p8-DRI showed lower viral titers in lung tissues and reduced viral pathology compared to vehicle-treated controls. By contrast, the antiviral effect of p8-DRI was abolished in OTUD4-deficient mice (Figs 5G-5I). These data indicate that p8-DRI targets OTUD4 to restrict MHV68 infection in vivo.

Ethics statement

All animal experiments were conducted in accordance with the guidelines approved by the Animal Care and Ethics Committee of Medical Research Institute, Wuhan University.

Mice

Otud4^fl/fl and ROSA26-CreERT2 mice were kindly provided by Dr. Bo Zhong (Wuhan University) [61,62]. Otud4^fl/fl mice were crossed with ROSA26-CreERT2 mice to obtain Otud4^fl/fl Cre-ERT2^-/- and Otud4^fl/fl Cre-ERT2^+/- offspring.

To knockout OTUD4 in primary mouse lung fibroblasts (MLFs) derived from Otud4^fl/fl Cre-ERT2^-/- and Otud4^fl/fl Cre-ERT2^+/- mice, MLFs were treated with 4-hydroxytamoxifen (1 μM; Sigma, H6278) for 3 days. For in vivo depletion of OTUD4, 6- to 8-week-old Otud4^fl/fl Cre-ERT2^-/- and Otud4^fl/fl Cre-ERT2^+/- mice were injected intraperitoneally with tamoxifen (80 mg/kg body weight, dissolved in corn oil; MCE, HY-13757A) for 5 consecutive days. After another 5 days, the mice were inoculated intranasally with MHV68 (4000 PFU). The lungs of the infected mice were collected 5 days post-infection, and viral gene expression and viral titer were quantified by reverse transcription quantitative PCR (RT-qPCR) and plaque assays.

Cell culture

HEK293T, NIH3T3 (ATCC), SLK, and BHK21 cells (kindly provided by Hongyu Deng, Institute of Biophysics, Chinese Academy of Sciences) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Sigma) supplemented with 10% fetal calf serum (FCS) (Lonsera, Shuangra Biotech, Shanghai, China) and 1% penicillin-streptomycin (HyClone) [20,63]. iSLK cells carrying doxycycline-inducible K-RTA [39] (kindly provided by Drs. Jae Jung, Cleveland Clinic, and Kevin Brulois, Stanford University) were maintained in DMEM supplemented with 10% FCS, 1% penicillin-streptomycin, puromycin (1 μg/mL), and G418 (250 μg/mL). SLK cells carrying the KSHV clone iBAC [64] (SLK.iBAC-GFP; kindly provided by Dr. Fanxiu Zhu, Florida State University) were maintained in DMEM supplemented with 10% FCS, 1% penicillin-streptomycin, and hygromycin B (500 μg/mL). BCBL-1 cells (kindly provided by Dr. Ke Lan, Wuhan University) were maintained in RPMI-1640 (HyClone) supplemented with 10% FCS and 1% penicillin-streptomycin. The BCBL-1-Tet-RTA cell line was generated by stably transducing BCBL-1 cells with a doxycycline-inducible RTA construct [38]. Primary mouse lung fibroblasts were generated as previously decribed [65,66]. Briefly, mouse lungs were minced and digested in calcium- and magnesium-free Hank’s Balanced Salt Solution containing 10 μg/ml type II collagenase and 20 μg/ml DNase I (Invitrogen) at 37 °C for 1 h. Cell suspension was centrifuged at 300 × g for 5 min, and the cells were then plated in culture medium (1:1 [v/v] DMEM/Ham’s F-12 supplemented with 10% FCS, penicillin–streptomycin, 15 mM HEPES, and 2 mM L-glutamine).

Antibodies and other reagents

The following antibodies and reagents were used for immunoblotting and immunoprecipitation: Mouse anti-FLAG monoclonal antibody (1:10000; Dia-An Biotechnology, Wuhan, China, catalog no. 2064); Mouse anti-HA monoclonal antibody (1:3000; Dia-An Biotechnology, Wuhan, China, catalog no. 2063); Mouse anti-β-actin monoclonal antibody (1:5000; Dia-An Biotechnology, Wuhan, China, catalog no. 2060); Rabbit anti-K-RTA monoclonal antibody (1:1000, Mabnus biotechnology, Wuhan, China); Rabbit anti-K-ORF55 polyclonal antibody (1:1000, Mabnus biotechnology, Wuhan, China); Mouse anti-KSHV ORF45 monoclonal antibody (1:1000; Santa Cruz, sc-53883); Mouse anti-KSHV ORF57 monoclonal antibody (1:1000; Santa Cruz, sc-135746); Mouse anti-c-Myc monoclonal antibody (1:1000; Santa Cruz, sc-40); Mouse anti-KSHV K8.1A/B monoclonal antibody (1:1000; Santa Cruz, sc-65446); Mouse anti-K8α monoclonal antibody (1:1000; Santa Cruz, sc-69797); Rabbit anti-OTUD4 polyclonal antibody (1:1000; Proteintech, 25070-1-AP); Mouse anti-USP7 monoclonal antibody (1:500; Santa Cruz, sc-137008); Rabbit anti-FLAG monoclonal antibody (ABclonal, AE092); IRDye 800CW Goat anti-Rabbit and anti-Mouse secondary antibodies (1:10000; LI-COR); Goat anti-Rabbit and anti-Mouse HRP Conjugated secondary antibodies (1:10000; Bio-Rad); Rabbit IgG (Proteintech, 20010049); Anti-FLAG agarose beads (Dia-An Biotechnology, Wuhan, China); Protein A/G agarose (GE Healthcare); Glutathione-Sepharose beads (Smart-lifesciences, Changzhou, China)

Additional reagents included: Reduced L-glutathione (Solarbio, Beijing, China); DAPI Fluoromount-G mounting medium (SouthernBiotech, 0100-20); Doxycycline (Dox), Formaldehyde, and Sodium butyrate (Sigma-Aldrich); Puromycin, Hygromycin B, and G418 (Invivogen); CellTiter-Glo cell viability assay kit (Promega); Genomic DNA extraction Kit (Tiangen, CDP304, Beijing, China).

Plasmids

MHV68 ORF50 was subcloned into pEF-FLAG-N or pEF-HA-N using standard molecular biology techniques; pHAGE-OTUD4 WT and the C45A mutant were kindly provided by Dr. Bo Zhong (Wuhan University) [62]; mOTUD4 WT were subcloned into pHAGE-vector and pEF-Myc-N, and the C45A and a DUB deletion mutants (Δ34-155 aa) were generated by site-directed mutagenesis; pCMV-FLAG/Myc-USP7, FLAG-MDM2, and HA-p53 were kindly provided by Dr. Jinfang Zhang (Wuhan University), and USP7 was subcloned into the pEF-HA-N vector [27]; HSV-1 ICP0 was subcloned into pEF-FLAG-N; The TRAF domain of human and murine USP7 (1-208 aa) was subcloned into pGEX-6p-1 (GE Healthcare), and the D164A and W165A mutants (murine are D165A and W166A) were introduced by site-directed mutagenesis; HA-Ub was kindly provided by Dr. Bo Zhong (Wuhan University); Short hairpin RNAs (shRNA) targeting OTUD4 and USP7 were constructed into pLKO.1 (Addgene). The shRNA sequences used in the study: shOTUD4, 5’-TATGCAATGCCTTAGTCATAA-3’; shUSP7, 5’-CAAGCAGTGCTGAAGATAATA-3’; shOTUD4 (m): #1 CCGTGTCACAAGCGCATTTAA, #2 GAGAAATTTGAAGCGTTTATA.

Peptides

Peptides p1 to p12 (S1A Fig) were synthesized by Sangon Biotech (Shanghai, China) with 95% purity. The Tat-fused peptides in Fig 1C consisted of the corresponding peptides conjugated to the Tat_47-57 peptide (YGRKKRRQRRR) and two glycine linker residues (QYAOBIO, Suzhou, China). The peptides p8-DRI (nssqsasqnvpprrrqrrkkrGy) and p2-DRI (iesndedavepprrrqrrkkrGy) were synthesized using D-amino acids in a retro-reversed sequence with 95% purity (QYAOBIO, Suzhou, China). The peptide p8-m (YGRKKRRQRRRGGVSQSPSQNSN) was synthesized with 95% purity (QYAOBIO, Suzhou, China). All the peptides were acetylated at the N-terminus and amidated at the C-terminus to mimic the native peptide structure. The peptides were dissolved in PBS to generate 1 mM stock solutions for in vitro experiments and 5 mg/ml stock solutions for in vivo experiments.

Surface plasmon resonance analysis

The interaction between USP7-TRAF and the candidate peptides was assessed by surface plasmon resonance (SPR) using the Biacore T200 system (Cytiva). Recombinant USP7-TRAF protein was immobilized on an activated carboxymethylated dextran (CM5) sensor chip to approximately 8000 response units (RU) using an amine coupling method. Gradient concentrations of peptides were injected at a flow rate of 30 μL/min in running buffer [0.05% (v/v) Tween 20 in PBS]. The results were analyzed using Biacore T200 evaluation software (version 2.0).

Proximity ligation assay

To detect the in situ interaction between OTUD4 and USP7, a proximity ligation assay (PLA) was conducted using the Duolink kit (DU092101, Sigma-Aldrich) according to the manufacturer’s instructions. Briefly, SLK.BAC-FLAG-OTUD4 cells treated with Dox (1 μg/ml) and the indicated peptides (100 μM) for 24h were fixed with 4% paraformaldehyde for 10 minutes, permeabilized in 0.1% Triton X-100 for 5 minutes, and blocked with 10% goat serum for 1 h. Cells were then incubated overnight with rabbit anti-FLAG (1:500, ABclonal, AE092) and mouse anti-USP7 (1:100, Santa Cruz, sc-137008) monoclonal antibodies. After washing, cells were incubated with secondary antibodies conjugated to PLA probes at 37°C for 1 h. Ligation and amplification were then performed, and slides were mounted with ProLong Gold mounting medium. Images were acquired using a laser scanning confocal microscope (Leica Stellaris 5) and processed using ImageJ [20].

RNA Extraction and RT-qPCR

For assessing the impact of peptides on viral replication, SLK.iBAC-GFP or BCBL-1-Tet-K-RTA cells were treated with doxycycline (Dox, 1 μg/ml) for 24 h in the presence of indicated peptides (100 μM). MLF and NIH3T3 cells were infected with MHV68-GFP at a multiplicity of infection (MOI) of 0.01 in the presence of indicated peptides (100 μM). For assessing the impact of peptides on viral latency, BCBL-1-Tet-K-RTA cells were treated with the indicated peptides (100 μM) for 48 h. Total RNA was extracted using TRIzol reagent (Takara) following the manufacturer’s instructions. cDNA was synthesized using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The resulting cDNA was diluted 20-fold and subjected to quantitative PCR (qPCR) analysis using SYBR green qPCR master mix (Bimake, Shanghai, China). The relative quantification of target genes was normalized to ACTB. Primer sequences were listed in Supplementary S1 Table.

Cell viability assay

SLK.iBAC-GFP cells were seeded in a 96-well plate at a density of 1 × 10⁵ cells/well. The cells were then treated with doxycycline (Dox, 1 μg/ml) and sodium butyrate (0.5 mM) to induce lytic reactivation in the presence of the indicated peptides (100 μM) for 48 h. After treatment and a 30-min equilibration at room temperature, CellTiter-Glo Reagent (Promega, G7570) was added in equal volumes to culture medium. Plates underwent orbital shaking (2 min) for lysis, followed by a 10-min incubation for signal stabilization and luminescence recording (0.25-1 sec integration).

Protein structure prediction

We leveraged AlphaFold3 with default settings to predict the structural complex of USP7-TRAF and p8, USP7-TRAF and p8m, murine USP7-TRAF and p8, as well as murine USP7-TRAF and p8-m [30]. ChimeraX (1.7.1) was employed to visualize and recolor the structural information.

GST pull-down assay

For protein purification, GST, GST-USP7-TRAF WT, D164A, or W165A, and GST-USP7- murine TRAF WT, D165A, or W166A were expressed in E. coli BL21 (DE3). Protein expression was induced with IPTG (0.5 mM) at 18°C overnight. Following induction, the cells were harvested and lysed in lysis buffer (20 mM Tris-Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 1% Triton X-100, 0.2 mM PMSF), followed by sonication on ice for 15 minutes. The lysates were incubated with glutathione-sepharose beads (Smart-lifesciences, Changzhou, China) at 4°C for 4 h. Bound proteins were extensively washed with wash buffer (20 mM Tris-Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 1% Triton X-100), eluted with elution buffer (20 mM Tris-Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 10 mM reduced L-glutathione), and subsequently dialyzed against dialysis buffer (20 mM Tris-Cl, pH 8.0, 150 mM NaCl, 10% glycerol).

For binding assays, purified GST or GST-USP7-TRAF (human or murine) was incubated with FLAG-OTUD4 (human or murine) expressed in HEK293T cells at 4°C for 4 h. Subsequently, 10 μL of Glutathione Sepharose was added, followed by rotation for an additional 2 h at 4°C. For competition assays, pGFP, p8, p8m or p8-m peptides (100 μM) were included throughout the incubation process. The beads were extensively washed with lysis buffer (50 mM Tris-Cl, pH 8.0, 150 mM NaCl, 1% Triton X-100, 1 × proteinase inhibitors), and the bound proteins were recovered by boiling with 1 × SDS loading buffer at 95°C for 5 min. The samples were then analyzed by immunoblotting.

Co-immunoprecipitation

HEK293T cells were transfected with the specified constructs and subsequently treated with the indicated peptide (100 µM) 6 h post-transfection. At 24 h post-treatment, the cells were harvested and lysed in NP-40 lysis buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 1% NP-40, 1 mM EDTA) containing a protease inhibitor cocktail. Cell lysates were centrifuged at 12,000 rpm for 10 min at 4°C and then the supernatants were incubated with anti-FLAG beads (Dia-An Biotechnology, Wuhan, China) at 4°C for 4 h. The beads were then collected by centrifugation at 4,000 rpm for 2 min at 4°C and washed thoroughly with NP-40 lysis buffer to eliminate unspecific bound proteins. The binding proteins were released by boiling in SDS sample buffer for 20 min, separated by SDS-PAGE and analyzed by immunoblotting.

Ubiquitination assay

HEK293T cells were co-transfected with FLAG-m-RTA, HA-Ub, and Myc-mOTUD4 WT, the C45A mutant, or the ΔDUB mutant. After 16 h, the transfected cells were treated with MG132 (10 μM) for an additional 10 h. The cells were collected and lysed in 1% Triton X-100 lysis buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 1% Triton X-100, 1 mM EDTA, with protease inhibitors) supplemented with 1% SDS and boiled for 5 minutes. The lysates were diluted 10-fold to reduce the SDS concentration to 0.1%. The diluted lysates were subjected to immunoprecipitation with FLAG beads, and the immunoprecipitated proteins were analyzed by immunoblotting.

Quantification of KSHV infectious units

SLK.iBAC-GFP cells were treated with Dox (1 μg/ml) and sodium butyrate (0.5 mM) to induce lytic reactivation in the presence of indicated peptides (100 μM). The supernatants were collected at the specified time points and used to infect HEK293T cells at appropriate dilutions. The infected cells were collected, fixed, and analyzed by flow cytometry 24 h post-infection. FlowJo 10.0 software was used to analyze the data, and KSHV infectious units were quantified based on the percentage of GFP-positive cells.

Quantification of viral genome copy number

For assessing the impact of peptides on viral lytic reactivation, BCBL-1-Tet-K-RTA cells were treated with Dox (1 μg/ml) and sodium butyrate (0.5 mM) for 48 h to induce lytic reactivation in the presence of indicated peptides (100 μM). The supernatants (500 μl) were collected and treated with 7.5 U of DNase I (Solarbio, Beijing, China) for 1 h at 37°C. Following DNase I treatment, 30 μl of proteinase K (20 mg/ml, Solarbio, Beijing, China) and 50 μl of 20% SDS were added, and the mixture was incubated at 65°C for 1 h. Genomic DNA was extracted using the phenol-chloroform extraction method [38], resuspended in 50 μl of TE buffer, diluted 20-fold, and quantified by qPCR. A standard curve was generated using serial dilutions of a pEF-FLAG-K-RTA plasmid. For assessing the impact of peptides on viral latency, BCBL-1-Tet-K-RTA cells were treated with the indicated peptides (100 μM) for 48 h. Genomic DNA was extracted using the standard extraction method (Tiangen, Beijing, China). Primer sequences used for quantification were provided in Supplementary S1 Table.

Generation of stable cell lines

Lentiviruses containing the indicated genes or shRNA constructs were generated as previously described [67]. NIH3T3, MLF, and SLK.iBAC-GFP cells were infected with the lentiviruses, and selected with puromycin (1 μg/ml) 2 days post-infection. For reconstitution experiments, MLF OTUD4 knockout cells were infected with lentiviruses containing vector control, mOTUD4 WT, mOTUD4-C45A, or the DUB depletion mutant, and were selected with puromycin (1 μg/ml). To generate SLK.iBAC-GFP stable cell lines containing the K-RTA mutants, BAC DNA (10 μl, ~2 μg) was transfected into SLK cells seeded in a 6-well plate using Fugene HD (Promega). The transfected cells were selected with hygromycin B (500 μg/ml) at 2 days post-transfection until GFP-positive colonies were sufficiently amplified.

Hematoxylin and Eosin (H&E) staining

Mouse lung tissue samples were fixed in 10% formalin solution (Sigma) overnight. The fixed tissue samples were then dehydrated, embedded in paraffin, and sectioned into 3-μm slices. The tissue sections were stained using standard H&E staining protocols and analyzed microscopically.

Statistical analysis

GraphPad Prism (version 8) was used for all statistical analysis. Data are presented as the mean of at least three independent experiments, and error bars denote standard deviation (S.D.). Statistical significance was determined using two-tailed student’s t test or analysis of variance (ANOVA). Significant differences are indicated by p value (*p<0.05, **p<0.01, ***p<0.001).