Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Zebrafish mylipb attenuates antiviral innate immunity through two synergistic mechanisms targeting transcription factor irf3

  • Zhi Li,

    Roles Conceptualization, Data curation, Investigation, Software, Validation, Visualization, Writing – original draft

    Affiliations State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China, State Key Laboratory of Biocatalysis and Enzyme Engineering, School of Life Sciences, Hubei University, Wuhan, China

    ⨯
  • Jun Li,

    Roles Conceptualization, Data curation, Formal analysis, Visualization

    Affiliations State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China, University of Chinese Academy of Sciences, Beijing, China

    ⨯
  • Ziyi Li,

    Roles Investigation, Validation

    Affiliations State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China, University of Chinese Academy of Sciences, Beijing, China

    ⨯
  • Yanan Song,

    Roles Investigation, Validation

    Affiliations State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China, University of Chinese Academy of Sciences, Beijing, China

    ⨯
  • Yanyi Wang,

    Roles Formal analysis

    Affiliations State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China, University of Chinese Academy of Sciences, Beijing, China

    ⨯
  • Chunling Wang,

    Roles Methodology

    Affiliation State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China

    ⨯
  • Le Yuan,

    Roles Methodology

    Affiliations State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China, University of Chinese Academy of Sciences, Beijing, China

    ⨯
  • Wuhan Xiao ,

    Roles Conceptualization, Funding acquisition, Project administration, Writing – review & editing

    w-xiao@ihb.ac.cn (WX); wangjing@ihb.ac.cn (JW)

    Affiliations State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China, University of Chinese Academy of Sciences, Beijing, China, Hubei Hongshan Laboratory, Wuhan, China, The Innovation of Seed Design, Chinese Academy of Sciences, Wuhan, China

    ⨯
  • Jing Wang

    Roles Conceptualization, Funding acquisition, Project administration, Writing – original draft, Writing – review & editing

    w-xiao@ihb.ac.cn (WX); wangjing@ihb.ac.cn (JW)

    Affiliations State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China, University of Chinese Academy of Sciences, Beijing, China, Hubei Hongshan Laboratory, Wuhan, China

    ⨯

Abstract

IFN regulatory factor 3 (IRF3) is the transcription factor crucial for the production of type I IFN in viral defence and inflammatory responses. The activity of IRF3 is strictly modulated by post-translational modifications (PTMs) to effectively protect the host from infection while avoiding excessive immunopathology. Here, we report that zebrafish myosin-regulated light chain interacting protein b (mylipb) inhibits virus-induced type I IFN production via two synergistic mechanisms: induction of autophagic degradation of irf3 and reduction of irf3 phosphorylation. In vivo, mylipb-null zebrafish exhibit reduced lethality and viral mRNA levels compared to controls. At the cellular level, overexpression of mylipb significantly reduces cellular antiviral capacity, and promotes viral proliferation. Mechanistically, mylipb associates with irf3 and targets Lys 352 to increase K6-linked polyubiquitination, dependent on its E3 ubiquitin ligase activity, leading to autophagic degradation of irf3. Meanwhile, mylipb acts as a decoy substrate for the phosphokinase tbk1 to attenuate irf3 phosphorylation and cellular antiviral responses independent of its enzymatic activity. These findings support a critical role for zebrafish mylipb in the limitation of antiviral innate immunity through two synergistic mechanisms targeting irf3.

Author summary

As an indispensable transcription factor for antiviral innate immunity, IRF3 activity is tightly regulated by post-translational modifications to effectively protect the host from infection while avoiding excessive immunopathology. In this study, we report that zebrafish mylipb is induced by viral stimulation, which negatively regulates irf3-mediated antiviral innate immunity. In mylipb-/-, the antiviral capacity and IFN response are significantly higher than that in mylipb+/+. Furthermore, mylipb negatively regulates antiviral innate immunity by two synergistic mechanisms: mylipb promotes K6-linked polyubiquitination of irf3 at lysine 352; mylipb acts as a decoy substrate for the phosphokinase tbk1 to attenuate irf3 phosphorylation. Our findings expand our knowledge of the negative regulatory mechanisms of IRF3 and reveal a novel function of mylipb in innate antiviral responses.

Citation: Li Z, Li J, Li Z, Song Y, Wang Y, Wang C, et al. (2024) Zebrafish mylipb attenuates antiviral innate immunity through two synergistic mechanisms targeting transcription factor irf3. PLoS Pathog 20(5): e1012227. https://doi.org/10.1371/journal.ppat.1012227

Editor: Jacob S. Yount, The Ohio State University, UNITED STATES

Received: September 21, 2023; Accepted: April 26, 2024; Published: May 13, 2024

Copyright: © 2024 Li et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting Information files.

Funding: This work was supported by grants from The Strategic Priority Research Program of the Chinese Academy of Sciences (XDA24010308 to WX); by the National Natural Science Foundation of China (31972786 to JW and 31830101 to WX); by the Innovative Research Group Project of the National Natural Science Foundation of China (31721005 to WX). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Innate immunity represents an evolutionary conserved mechanism that serves as the host’s initial defence against invading pathogens of microbial pathogens [1–3]. The recognition of conserved pathogen-associated molecular patterns (PAMPs) by cellular pattern recognition receptors (PRRs) is essential for the initiation of the innate antiviral immune response [4–8]. Virus-derived nucleic acids are mainly recognized by the DNA sensor cyclic guanosine monophosphate-adenosine monophosphate synthase (cGAS) and the RNA sensors retinoic acid-inducible gene 1 (RIG-I)-like receptors (RLRs), including RIG-I and melanoma differentiation-associated gene 5 (MDA5), and laboratory of genetics and physiology 2 [LGP2, 9–14]. Activation of the sensors recruits the signaling adaptor proteins, including STING (stimulator of interferon [IFN] genes protein) and MAVS (mitochondrial antiviral signalling protein), which then activate the downstream signaling molecules TANK binding kinase 1 [TBK1, 15–19]. These cascades eventually converge on the activation of the transcription factor IFN regulatory factor 3 (IRF3), which serves as an indispensable transcription factor for type I IFN production and subsequent ISGs for host antiviral state [20–22]. Upon receiving upstream signals, IRF3 undergoes several processes to activate the type I IFN pathway, including phosphorylation, dimerisation, nuclear translocation, promoter binding and facilitating transcriptional activation of type I IFN genes [21–23].

Post-translational modifications (PTMs), such as phosphorylation, ubiquitination, acetylation, deamidation, and methylation have been shown to influence PRRs-dependent immune responses via their modifications of receptors, adaptors, kinase, and transcriptional factors [24–28]. In particular, ubiquitination plays an indispensable role in fine-tuning the RLR-mediated antiviral response [29–33]. Ubiquitin ligases serve as key regulators of this signaling by precisely regulating the dynamic ubiquitination process [29,34,35]. The ubiquitin molecule itself can be ubiquitinated at seven internal lysine residues (K6, K11, K27, K29, K33, K48 or K63) to produce the corresponding polyubiquitination modifications [34]. Among these, polymeric chains based on K48 and K63 have been extensively studied. For example, K48-linked polyubiquitination is the canonical signal that mediates protein degradation in a proteasome manner, whereas K63-linked polyubiquitination mainly contributes to signal transduction, DNA repair enzymatic activity and protein endocytosis [36]. Although K48- and K63-linked polyubiquitination are widely recognized to influence innate antiviral immune responses, other atypical polyubiquitination modes such as K6-, K11-, K27-, K29-, K33- and linear-linked polyubiquitination are being investigated for their distinct roles in innate immunity [37–40]. As a key transcriptional factor in IFN-I signaling, IRF3 activity has been shown to be regulated by ubiquitination and deubiquitination [38,41–46]. Meanwhile, IRF3 phosphorylation is required for its homodimerisation and nuclear translocation, and the mechanisms underlying phosphorylation-triggered activation of IRF3 have been the subject of many extensive studies [18,47]. Understanding the mechanisms that regulate IRF3 phosphorylation and ubiquitination has been an interesting topic in the field of innate immunity.

Myosin regulatory light-chain interacting protein (MYLIP, also known as inducible degrader of the low-density lipoprotein receptor) is currently the only really interesting new gene (RING) family ubiquitin ligase E3 with FERM (Band 4.1, ezrin-radixin-moesin) domain [48,49]. The function of MYLIP has been reported to monitor cellular and organismal cholesterol homeostasis by promoting the ubiquitin-mediated degradation of lipid metabolism proteins such as low-density lipoprotein receptor (LDLR), very-low-density lipoprotein receptor (VLDLR), and apolipoprotein E receptor 2[ApoER2, 50–55]. In addition, MYLIP can modulate its own stability by forming a homodimer followed by autoubiquitination and degradation via the proteasome pathway [56,57]. However, the role of MYLIP in vertebrate virus-induced innate immunity signaling is still largely unknown.

In this study, we report that mylipb-null zebrafish are hyposensitive to SVCV infection and exhibit an enhanced induction of the IFN response. Our in vitro data suggest that zebrafish mylipb associates with irf3 and increases K6-linked polyubiquitination at Lys 352, leading to the induction of autophagic degradation of irf3. In addition, mylipb acts as a decoy substrate for the phosphokinase tbk1 to attenuate irf3 phosphorylation. Our results demonstrate that zebrafish mylipb is a negative regulator of type I IFN signaling and the cellular antiviral response, with two synergistic mechanisms working together to target irf3.

Results

Zebrafish mylipb is induced by poly I:C treatment and SVCV infection

In zebrafish, there are two orthologous genes of MYLIP, including mylipa and mylipb. To know the behaviour of zebrafish mylip in response to viral infection, ZFL cells were stimulated with poly I:C, a mimic of RNA virus [58], for 0–48 h. Using quantitative real-time PCR (qRT-PCR) assays, we found that similar to the key antiviral gene, ifn1 [59], mRNA expression of mylipb was more significantly upregulated than mylipa (Fig 1A). Consistently, we challenged ZFL cells with SVCV for 0–48 h and found that mylipb expression was also increased more notably than mylipa (Fig 1B). MYLIP is transcriptionally induced by the liver X receptor (LXR), a transcription factor involved in the regulation of cholesterol metabolism [55]. We then challenged ZFL with T0901317, an LXR agonist, for 24 h and found that only mylipa expression was significantly upregulated at different doses (Fig 1C). However, mylipb expression was barely affected by T0901317. A similar trend was observed during the time gradient treatment with T0901317 (Fig 1D). Therefore, we focused our subsequent assays on mylipb function.

thumbnail
Download:
Fig 1. Zebrafish mylipb is upregulated upon poly I:C treatment and SVCV infection.

(A) Zebrafish mylipb as well as ifn1, but not mylipa mRNA was induced by poly I:C in ZFL cells. ZFL cells were seeded in 60-mm plates overnight and treatment with poly I:C (1 μg/mL) for indicate time. (B) Zebrafish mylipb as well as ifn1, but not mylipa mRNA was induced by SVCV (virus strain OMG067) infection (MOI of 1) in ZFL cells. ZFL cells were seeded in 60-mm plates overnight and infected with SVCV for different time. (C) Zebrafish mylipa but not mylipb mRNA was induced by LXR agonist T0901317 in a dose-dependent manne in ZFL cells. ZFL cells were seeded in 60-mm plates overnight and treatment with T0901317 for 24 h. (D) Zebrafish mylipa but not mylipb mRNA was induced by LXR agonist T0901317 (1 μM) in a indicate time in ZFL cells. ZFL cells were seeded in 60-mm plates overnight and treatment with T0901317 for indicate time. Total RNA was extracted for examining the expression of target genes by quantitative real-time PCR (qRT-PCR). All data are presented as mean values based on three repeated experiments, and error bars indicate the ± SD. *,P < 0.05, **, P<0.01; ***, P < 0.001; ****, P< 0.0001.

https://doi.org/10.1371/journal.ppat.1012227.g001

Mylipb exhibits proviral effects both in vivo and in vitro

To understand the physiological role of mylipb in the antiviral response in vivo and in vitro, we first generated mylipb-deficient zebrafish using CRISPR-Cas9 and obtained a mutant line with a 7-nucleotide deletion in exon 3 of mylipb (S1A and S1B Fig). Crossing mylipb+/- resulted in offspring with mylipb+/+, mylipb+/- and mylipb-/- genetic backgrounds in a Mendelian ratio (1:2:1), and no obvious defects in growth rate and reproductive ability were detected in mylipb-/- zebrafish under normal conditions. qRT-PCR assay confirmed that mylipb was efficiently disrupted (S1C Fig). We challenged mylipb-/- larvae (3 days post-fertilisation [dpf]) and mylipb+/+ larvae (3 dpf) (having a wild-type allele of mylipb) (WT) with high titer SVCV and photographed the larvae after 18 h (Fig 2A). We found that mylipb-deficient zebrafish larvae were more resistant to SVCV-induced death (Fig 2A and 2B). We then injected SVCV intraperitoneally (i.p.) into mylipb-/- and mylipb+/+ adult zebrafish (3 months post-fertilisation [mpf]) and used cell culture medium as a control, and subsequently observed their phenotypes. Compared to SVCV-injected WT zebrafish, SVCV-injected mylipb-deficient zebrafish showed less abdominal swelling and haemorrhagic symptoms (Fig 2C). In addition, we counted dead zebrafish at different time points after SVCV injection and plotted a survival curve. As shown in Fig 2D, after challenge with SVCV, mylipb-/- zebrafish showed a higher survival rate compared to WT zebrafish (Fig 2D). Consistently, mylipb-/- larvae exhibited lower mRNA expression of N-, P- and G-protein genes of SVCV genes than WT larvae (Fig 2E).

thumbnail
Download:
Fig 2. Zebrafish mylipb exhibits proviral effects both in vivo and in vitro.

(A) Representative images of mylipb-null zebrafish larvae (mylipb-/-) (3 dpf) and WT siblings (mylipb+/+) (3 dpf) infected with or without SVCV for 18 h. Zebrafish larvae (3 dpf) were pooled in a disposable 60-mm cell culture dish filled with 5mL of egg water plus 2 mL SVCV (∼2.5×107TCID50/ml). Dead larvae were identified by lack of movement, absence of blood circulation, and bodily degeneration (indicated by red arrows). (B) mylipb-null zebrafish (mylipb-/-) (n = 48, 3 dpf) were more resistance to SVCV infection than the WT (mylipb+/+) (n = 48, 3 dpf) based on the survival ratio. SVCV viruses (∼2.50 × 107 TCID50/mL) were added to mylipb-null and WT larvae, and the numbers of dead larvae were counted every hour from 0 to 24 h. (C) mylipb-null zebrafish adults are more resistance to SVCV infection than WT zebrafish. mylipb-null zebrafish (mylipb-/-)(3 months postfertilization [3 mpf]) displayed less symptoms of abdominal hemorrhage after SVCV infection than WT zebrafish (mylipb+/+)(3 mpf). The zebrafish were i.p. injected with either 10 μL cell culture medium or 10 μL SVCV(∼2.50 × 107 TCID50/mL). The red arrows indicate hemorrhage regions. (D) mylipb-null zebrafish (mylipb-/-) (3 mpf) (n = 10) were more resistance to SVCV infection than the WT (mylipb+/+) (3 mpf) (n = 10) based on the survival ratio. (E) The virus replication number was lower in mylipb-null zebrafish larvae than in the WT zebrafish after infection with SVCV. mylipb-null larvae (mylipb-/-) and the WT larvae (mylipb+/+) are offspring of siblings. 30 larvae (3 dpf) were pooled in a disposable 60-mm cell culture dish filled with 5 mL of egg water and 0.5 mL of SVCV (∼2.5×107TCID50/ml).. After challenge for 24 h, the mRNA expression of N protein, P protein, and G protein of SVCV was detected by qRT-PCR analysis. (F-H) The induction of key antiviral genes, including mxc (F), ifn1 (G), lta (H) upon SVCV infection was higher in mylipb-null larvae (mylipb-/-) compared with the WT larvae (mylipb+/+). (I) Overexpression of mylipb reduced cell survival after SVCV infection in EPC cells. EPC cells were transfected with Myc-mylipb or empty vector. At 24 h post-transfection, the cells were infected with SVCV at the dose indicated for 48 h. Then, the cells were fixed with 4% paraformaldehyde and stained with 1% crystal violet. (J) Overexpression of mylipb increased virus titer in SVCV-infected EPC cells. The culture supernatant was collected from EPC cells infected with SVCV (MOI of 1), and the viral titer was measured by plaque assay. The results are representative of three independent experiments. (K) Overexpression of mylipb increased copy number of SVCV-related genes in SVCV-infected EPC cells. EPC cells were transfected with Myc-mylipb or empty vector for 24 h and infected with SVCV (MOI of 1). After 24 h, total RNAs were extracted for examining the mRNA levels of the N, P, and G gene of SVCV by qRT-PCR analysis. Western blotting tests to detect the overexpression of mylipb. All data are presented as mean values based on three repeated experiments, and error bars indicate the ± SD. *,P < 0.05, **, P<0.01; ***, P < 0.001; ****, P< 0.0001.

https://doi.org/10.1371/journal.ppat.1012227.g002

To evaluate the alteration of IFN response by mylipb deficiency, we compared the mRNA expression of three antiviral genes, including ifn1, mxc and lta [60], between mylipb-/- and WT larvae following SVCV infection. qRT-PCR assay showed that the transcription of these antiviral genes induced by SVCV was significantly increased in mylipb-/- larvae compared to WT larvae (Fig 2F–2H). Inflammatory genes also contribute to the viral pathogenesis, we also compared the mRNA expression of inflammation factor, including il-1β, il8, tnfα, between mylipb-/- and WT larvae following SVCV infection. qRT-PCR assay showed that the transcription of these genes induced by SVCV was significantly decreased in mylipb-/- larvae compared to WT larvae (S2A Fig). In addition, upon SVCV infection at the cellular level in vitro, mylipb significantly inhibited the antiviral capacity and enhanced the cytopathogenic effect (CPE) (Fig 2I). Next, dramatically increased viral titers and upregulated viral gene transcriptions (N, P and G genes) were found in mylipb-overexpressing EPC cells compared to controls (Fig 2J–2K). Taken together, these findings indicate that mylipb is a host negative factor against viral infections in vivo and in vitro.

Mylipb inhibits poly I:C and SVCV-induced IFN activation

Since IFN activation plays a key role in the host’s antiviral capacity, it is necessary to further investigate the effect of mylipb on IFN response. Using promoter assays, we found that overexpression of mylipb suppressed the ISRE reporter (a commonly used reporter for monitoring viral infection)[61] induced by either poly I:C transfection or SVCV infection in EPC cells (Fig 3A and 3B). Consistent with the ISRE reporter results, mylipb significantly inhibited Dr-IFNφ1-luc (the zebrafish ifnφ1 promoter) activity induced by poly I:C or SVCV infection (Fig 3C and 3D). Subsequently, the effect of mylipb on IFN system transcription was also monitored. Consistent with the promoter assays, overexpression of mylipb strongly reduced the expression of ifn and two typical IFN-stimulated genes (viperin and isg15, 60) in EPC cells upon poly I:C or SVCV stimulation (Fig 3E and 3F). In addition, overexpression of mylipb up-regulated the expression of inflammatory genes il1-β, il8, tnfα in EPC cells upon SVCV stimulation (S2B Fig). These results demonstrate that mylipb acts as a suppressor of IFN activation.

thumbnail
Download:
Fig 3. Zebrafish mylipb negatively regulates IFN-I signaling.

(A-B) Overexpression of mylipb suppressed the activity of ISRE reporter (A), zebrafish IFNφ1 reporter (Dr-IFNφ1-Luc.) (B), induced by poly I:C transfected EPC cells. We transfected EPC cells with the indicated reporters (0.1 μg/well) along with Myc-empty vector or Myc-mylipb vector (0.2 μg/well). After 24 h, we transfected the cells with poly I:C (1 μg/mL) for 24 h and then conducted luciferase reporter activity and western blot assays. (C-D) Overexpression of mylipb suppressed the activity of ISRE reporter (C), zebrafish IFNφ1 reporter (Dr-IFNφ1-Luc.) (D), induced by SVCV infection in EPC cells. We transfected EPC cells with the indicated reporters (0.1 μg/well) along with Myc-empty vector or Myc-mylipb vector (0.2 μg/well). After 24 hours, we transfected the cells with SVCV (MOI of 1) for 24 hours and then conducted luciferase reporter activity and western blot assays. (E) Overexpression of mylipb suppressed expression of ifn, isg15, and viperin induced by poly I:C in EPC cells. EPC cells were transfected with Myc-mylipb or empty vector. After 24 hours, we transfected the cells with poly I:C (1 μg/mL) for 24 hours, total RNAs were extracted for examining the mRNA levels of ifn, isg15, and viperin by qRT-PCR analysis. Western blotting tests to detect the overexpression of mylipb. (F) Overexpression of mylipb suppressed expression of ifn, isg15, and viperin induced by SVCV infection in EPC cells. EPC cells were transfected with Myc-mylipb or empty vector for 24 h and infected with SVCV (MOI of 1). After 24 h, total RNAs were extracted for examining the mRNA levels of ifn, isg15, and viperin by qRT-PCR analysis. Western blotting tests to detect the overexpression of mylipb. All data are presented as mean values based on three repeated experiments, and error bars indicate the ± SD. *,P < 0.05, **, P<0.01; ***, P < 0.001; ****, P< 0.0001.

https://doi.org/10.1371/journal.ppat.1012227.g003

Mylipb associates with and induces autophagic degradation of irf3

There is increasing evidence that the fish RLR signalling pathway plays a critical role in the activation of IFN production [3,13,62]. In order to determine the mechanisms of zebrafish mylipb in the negative regulation of the antiviral response, we examined the activity of the ISRE reporter and EPC-IFN-luc stimulated by overexpressing of key molecules of the RLR pathway, including rig-i, mda5, mavs, tbk1 and irf3 together with Myc-empty vector or Myc-tagged mylipb. Overexpression of the RLR signaling cascade factors significantly activated the activity of the ISRE reporter and EPC-IFN-luc (Fig 4A and 4B). However, co-expression of mylipb suppressed the activity induced by these factors, from upstream to downstream factors in the RLR signaling pathway (Fig 4A and 4B). These data suggest that mylipb may negatively regulate antiviral immunity by suppressing the transactivity of irf3.

thumbnail
Download:
Fig 4. Mylipb interacts with irf3 and induces autophagic degradation of irf3.

(A) Overexpression of mylipb suppressed rig-i–, mda5- mavs-, tbk1-, and irf3-induced activation of ISRE luciferase activity in EPC cells. (B) Overexpression of mylipb suppressed rig-i–, mda5- mavs-, tbk1-, and irf3-induced activation of EPC–IFN promoter luciferase reporter (EPC-IFN-luc) activity in EPC cells. (C) Immunofluorescence staining showed the predominant colocalization of mylipb and irf3 protein in the cytoplasm. HEK293T cells were co-transfected with Myc-mylipb and Flag-irf3. After 24 h, the cells were fixed and observed by confocal microscopy. Red signals represent overexpressed irf3, green signals represent overexpressed mylipb. (D) Mylipb associated with irf3. HEK293T cells seeded in 100-mm dishes were transfected with the indicated plasmids (4 μg each). After 24 h, total cell lysates were immunoprecipitated (IP) with anti-Flag antibody conjugated agarose beads. Then, the immunoprecipitates and cell lysates were detected with anti-HA or anti-Flag Ab, respectively. (E) Mylipb induced the degradation of irf3 in a dose-dependent manner. HEK293T cells were transfected with Myc-empty, Myc-mylipb, and Flag-irf3 for 24 h, and then the cells were harvested to perform immunoblotting. (F) The protein level of irf3 and p-irf3 was higher in mylipb-null zebrfish liver compared with that in WT zebrafish. mylipb-null zebrafish (3 mpf) and their WT siblings (3 mpf) were i.p. injected with (+) or without (-) SVCV at 10 μl/individual for 48 h, then their livers were dissected for Western blot analysis using anti-irf3, anti-p-irf3. (G) Immunoblotting of lysates from HEK293T cells transiently transfected with Myc-empty, Myc-mylipb, and HA-irf3 for 24 h and then cultured in the presence of the proteasome inhibitor, MG132 (20 μM), autophagy inhibitor, 3-MA (1 mM),or DMSO for 12 h. (H) Immunoblotting of lysates from HEK293T cells transiently transfected with Myc-empty, Myc-mylipb, and HA-irf3 for 24 h and then cultured in the presence of the autophagy inhibitor, Baf-A1 (100 nM), or DMSO for 12 h. (I) Immunoblotting of lysates from HEK293T cells transiently transfected with Myc-empty, Myc-mylipb, and HA-irf3 for 24 h and then cultured in the presence of the lysosome inhibitor, NH4Cl (5 mM), or H2O for 12 h. (J) Immunoblotting of lysates from HEK293T cells transiently transfected with Myc-empty, Myc-mylipb, and HA-irf3 for 24 h. (K)) HEK293T cells were co-transfected with Myc-mylipb or pCMV-Myc plus Flag-irf3 and GFP-LC3. After 24 h, the cells were fixed and observed by confocal microscopy. Red signals represent overexpressed irf3, green signals represent LC3 positive autophagosome accumulation.

https://doi.org/10.1371/journal.ppat.1012227.g004

To further investigate whether irf3 activity was directly affected by mylipb, we examined their protein-protein interactions. As shown in Fig 4C, immunofluorescence staining confirmed the predominant colocalization of mylipb and irf3 protein in the cytoplasm (Fig 4C). In addition, co-immunoprecipitation assays further demonstrated that ectopically expressed mylipb pulled down irf3 in HEK293T cells (Figs 4D and S3A). Previous studies have shown that MYLIP exerts its physiological function by inhibiting the stabilization of target proteins [54]. Therefore, we further investigated whether the inhibition of the RLR pathway by mylipb was achieved by affecting the stability of the irf3 protein. As expected, overexpression of mylipb resulted in a dose-dependent reduction of overexpressed irf3 protein (Fig 4E). Upon SVCV infection, irf3 protein level and phosphorylation of irf3 were detected, which appeared to be higher in mylipb-null zebrafish (mylipb-/-) compared with WT zebrafish (mylipb+/+) (Fig 4F).

The degradation mechanism of irf3 in this process was then investigated. Protein degradation is mediated by three classical mechanisms, namely the proteasome, autophagosome and lysosomal proteolysis pathways, which are disrupted by MG132, 3-methyladenine (3-MA) or Baf-A1 and NH4Cl, respectively. As shown in Fig 4G, MG132, a proteasomal inhibitor, had no effect on mylipb-induced irf3 protein degradation. However, 3-MA and Baf-A1, two autophagy inhibitors, clearly restored mylipb-induced irf3 protein degradation (Fig 4G and 4H), suggesting that mylipb might mediate autophagic degradation of irf3 protein. As expected, the addition of NH4Cl also restored mylipb-induced irf3 protein degradation, since the late stage of autophagy is involved in the lysosomal pathway (Fig 4I). Furthermore, overexpression of mylipb dose-dependently decreased the expression irf3 and was found to increase the levels of LC3-II (Fig 4J). Furthermore, during autophagy, conjugated LC3 coats the autophagosome membrane, so the observation of LC3 puncta formation is taken as an autophagy indicator. Confocal microscopy analysis revealed that LC3 puncta were significantly accumulated in cells overexpressing mylipb and irf3 (Fig 4K). To further strengthen this conclusion, HEK293T knockout cells for the essential autophagy genes ATG5 and BECN1 were used, and we found that the irf3 degradation induced by mylipb was detectable in wild-type (WT) cells but not in either ATG5 KO or BECN1 KO cells (S3B and S3C Fig).

Collectively, these data suggest that zebrafish mylipb induces autophagy-dependent degradation of irf3 to suppress RLR signaling activation.

Mylipb degradates irf3 dependent of its ubiquitin ligase activity

To further elucidate the mechanisms of mylipb’s effect on irf3 protein stability, we first performed domain mapping assays. The results showed that the zine finger (ZF) domain of mylipb is critical for its association with irf3 (Fig 5A and 5B). The cysteine residue at position 387 (C387) of the ZF domain is the enzymatic activity centre of MYLIP and necessary for maintaining the E3 ubiquitin ligase activity [55]. Amino acid sequence alignments revealed that C387, which corresponds to zebrafish C381, is evolutionarily conserved between human, mouse and zebrafish (S4A Fig). To investigate whether mylipb could enhance irf3 ubiquitination and depend on its enzymatic activity, we transfected mylipb-WT and ZF domain deletion mylipb (mylipb-ΔZF) together with flag-irf3 and His-Ub into HEK293T cells. In the presence of mylipb-WT or mylipb-1-416aa, irf3 ubiquitination was dramatically or partly increased (Figs 5C and S5A). However, substitution of the cysteine at position 381 with serine (C381S), deletion of the ZF domain (ΔZF) in mylipb or mylipb-1-279aa, mylipb-1-380aa abrogated irf3 polyubiquitination (Figs 5C and S5A), indicating that E3 ubiquitin ligase activity was required for mylipb-mediated irf3 ubiquitination. Consistently, we further confirmed that the ZF domian and C381 were also required for mylipb-mediated irf3 degradation (Fig 5D and 5E). Meanwhile, upon SVCV infection, ubiquitination of endogenous irf3 was decreased in mylipb-null zebrafish (mylipb-/-) compared with WT zebrafish (mylipb+/+) (Fig 5F).

thumbnail
Download:
Fig 5. Mylipb negatively regulates irf3 by promoting K6-linkd ubquitination of irf3 at lysine 352.

(A-B) The interaction between mylipb and irf3 protein mostly depended on the ZF domain of mylipb protein. HEK293T cells seeded in 100-mm dishes were transfected with the indicated plasmids (4 μg each). After 24 h, the cells were treated with 3-MA for 8 h. Total cell lysates were immunoprecipitated (IP) with anti-HA antibody conjugated agarose beads. Then, the immunoprecipitates and cell lysates were detected with anti-HA or anti-Flag Ab, respectively. (C) Mylipb promoted irf3 ubiquitination depended on ZF domain and ubiquitin ligase activity of mylipb. HEK 293T cells were transfected with Flag-irf3, Myc-mylipb-WT, Myc-mylipb-Δ381–416, Myc-mylipb-C381S, or empty vector, together with His-ubiquitin. At 24 h posttransfection, the cells were treated with 3-MA for 8 h. The cells were lysed using guanidinium chloride, and purifified with Ni2+-NTA agarose. (D) Mylipb induced the degradation of irf3 dependent of its ZF domain. HEK293T cells were transfected with Myc-mylipb-WT or its mutants, together with HA-irf3 for 24 h. The lysates were then subjected to IB with the indicated Abs. (E) Mylipb induced the degradation of irf3 dependent of its ubiquitin ligase activity. HEK293T cells were transfected with Myc-mylipb-WT or Myc-mylipb-C381S, together with HA-irf3 for 24 h. The lysates were then subjected to IB with the indicated Abs. (F) Ubiquitination assay of irf3 in mylipb-null (mylipb−/−) zebrafish liver and their WT (mylipb+/+) siblings. mylipb-null zebrafish (3 mpf) and their WT siblings (3 mpf) were i.p. injected with (+) or without (-) SVCV(∼2.50 × 107 TCID50/mL) at 10 μl/individual for 48 h, then their livers were dissected, and lysed with lysis buffer (100 μl). The supernatants were denatured at 95°C for 5 min in the presence of 1% SDS. The denatured lysates were diluted with lysis buffer to reduce the concentration of SDS (<0.1%). Denature-IP was conducted using anti-irf3 antibody and then subjected to immunoblotting with anti-Ubiquitin antibody. (G-H) Mylipb promoted K6-linked poly-ubiquitination of irf3. (I) Mylipb promoted K6-linked poly-ubiquitination at lysine 352 of irf3. (G-I) HEK 293T cells were transfected with Flag-irf3 or HA-irf3, Myc-mylipb, or empty vector, together with His-ubiquitin or its mutants. At 24 h posttransfection, the cells were treated with 3-MA for 8 h. The cells were lysed using guanidinium chloride, and purifified with Ni2+-NTA agarose. IB, immunoblot; KO, K-only; KR, K is mutated to R. (J) K352R mutation of irf3 abolished the inhibitory effect of mylipb on ISRE reporter activities in EPC cells. EPC cells were transfected with ISRE reporter and HA-irf3 or its mutants together with Myc-mylipb or empty vector for 24 h, and then conducted luciferase reporter activity assays. (K) K352R mutation abolished degradation of irf3 induced by mylipb. HEK293T cells were transfected with Myc-mylipb or empty vector, together with HA-irf3 or HA-irf3-K352R for 24 h. The lysates were then subjected to IB with the indicated Abs.

https://doi.org/10.1371/journal.ppat.1012227.g005

We also investigated which type of polyubiquitin linked to irf3 was increased by mylipb. As shown in Fig 5G and 5H, overexpression of mylipb effectively promoted K6-linked polyubiquitination of irf3, but not K11-, K27-, K29-, K33-, K48- and K63-linked polyubiquitination of irf3 (Figs 5G, 5H, and S5B). We then focused on screening which lysine(s) of irf3 were targeted by mylipb. Homology alignment analysis identified seven conservative lysine residues of mylipb from human, mouse and zebrafish (S6A Fig). Furthermore, overexpression of huMYLIP also destabilized huIRF3 (S6B Fig), suggesting that the ubiquitination sites they contain are evolutionarily conserved. Therefore, we constructed seven irf3 mutants irf3(K5R), irf3(K39R), irf3(K76R), irf3(K86R), irf3(K103R), irf3(K352R) and irf3(K401R) in which lysine residues at positions 5, 39, 76, 86, 103, 352 and 401 were specifically replaced by arginine. Ubiquitination assays showed that overexpression of mylipb significantly promoted K6 polyubiquitination of irf3(K5R), irf3(K39R), irf3(K76R), irf3(K86R), irf3(K103R) and irf3(K401R), but not irf3(K352R) (Fig 5H). We further confirmed that overexpression of mylipb suppressed the ISRE reporter activity induced by irf3(K5R), irf3(K39R), irf3(K76R), irf3(K86R), irf3(K103R) and irf3(K401R), but not irf3(K352R) (Fig 5I). Consistent with this notion, mylipb could not induce the degradation of irf3(K352R) (Fig 5J). These data suggest that zebrafish mylipb induces degradation of irf3 by promoting K6-linked polyubiquitination of irf3 at lysine 352.

To further investigate whether the enzymatic activity of mylipb is involved in the antiviral response. The results of promoter analysis and qRT-PCR analysis showed that mylipb-WT inhibited poly I:C- and SVCV-induced ISRE reporter and EPC-IFN-luc activity and the transcription of antiviral genes (Fig 6A–6D). Notably, although the enzyme-inactivated mylipb-C381S significantly rescued the inhibitory effect of IFN activation compared to mylipb-WT, it still had a partial negative regulatory function (Fig 6A–6D). Consistently, as shown in Fig 6E, 6F and 6G, overexpression of mylipb-C381S significantly impaired the ability to increase CPE, viral titer and mRNA expression of viral genes after SVCV infection in EPC cells compared to overexpression of mylipb-WT. However, overexpression of enzyme-inactivated mylipb still had a statistically significant enhancing effect compared to empty vector transfection (Fig 6E–6G).

thumbnail
Download:
Fig 6. Mylipb negatively regulates cellular antiviral response mainly dependent of its ubiquitin ligase activity.

(A) ISRE reporter activity and EPC-IFN-Luc activity in Myc-empty vector or Myc-mylipb-WT and Myc-mylpib-C381S-transfected EPC cells for 24 h, followed by transfection with or without poly I:C (1μg/mL) for 24 h. Western blotting tests to detect the overexpression of mylipb-WT and mylipb-C381S. (B) ISRE reporter activity and EPC-IFN-Luc activity in Myc-empty vector or Myc-mylipb-WT and Myc-mylipb-C381S-transfected EPC cells with or without SVCV (MOI of 1) infection for 24 h. Western blotting tests to detect the overexpression of mylipb-WT and mylipb-C381S. (C) qRT-PCR of ifn, isg15, and viperin mRNA in EPC cells transfected with Myc-empty or or Myc-mylipb-WT and Myc-mylipb-C381S-transfected EPC cells for 24 h, followed by transfection with or without poly I:C (1μg/mL) for 24 h. Western blotting tests to detect the overexpression of mylipb-WT and mylipb-C381S. (D) qRT-PCR of ifn, isg15, and viperin mRNA in EPC cells transfected with Myc-empty or or Myc-mylipb-WT and Myc-mylipb-C381S-transfected EPC cells for 24 h, followed by infection with or without SVCV (MOI of 1) for 24 h. Western blotting tests to detect the overexpression of mylipb-WT and mylipb-C381S. (E) The plaque assay of EPC cells transfected with Myc-empty or or Myc-mylipb-WT and Myc-mylipb-C381S-transfected EPC cells for 24 h, followed by infection with or without SVCV(MOI:0.1–100) for 48 h. (F) Determination of SVCV titre in culture medium of EPC cells transfected with Myc-empty or or Myc-mylipb-WT and Myc-mylipb-C381S-transfected EPC cells for 24 h, followed by infection with or without SVCV(MOI:1) for 48 h. (G) qRT-PCR of N, P, and G mRNA in EPC cells transfected with Myc-empty or or Myc-mylipb-WT and Myc-mylipb-C381S-transfected EPC cells for 24 h, followed by infection with or without SVCV for 24 h. Western blotting tests to detect the overexpression of mylipb-WT and mylipb-C381S. qRT-PCR data are presented as mean values based on three repeated experiments, and error bars indicate the ± SD. *,P < 0.05, **, P<0.01; ***, P < 0.001; ****, P< 0.0001.

https://doi.org/10.1371/journal.ppat.1012227.g006

Taken together, the results suggest that mylipb degrades irf3 in a manner dependent on its ubiquitin ligase activity, but also suggest that there are other mechanisms by which mylipb negatively regulates antiviral responses in addition to promoting irf3 degradation.

Mylipb decreases tbk1-mediated irf3 phosphorylation and cellular antiviral response

Zebrafish tbk1 kinase activity and tbk1-mediated irf3 phosphorylation play an important role in defence against viral infection. To investigate whether mylipb could regulate tbk1-mediated irf3 phosphorylation in the antiviral response, we first overexpressed tbk1 in the absence or presence of mylipb and examined the gel shift of irf3. As shown in Figs 7A and S7A, overexpression of tbk1 resulted in a shift of irf3 in the gel, which was reduced by CIP treatment (Figs 7A and S7A). However, in the presence of either mylipb-WT or mylipb-C381S, the shift band became weaker compared to that in the absence of mylipb, suggesting that mylipb could regulate tbk1-mediated irf3 phosphorylation (Fig 7A). Subsequent immunoblot analysis indicated that mylipb did not significantly disrupt the protein level of tbk1, which was distinct from mylipb-mediated degradation of irf3 (Fig 7B). Notably, in the presence of tbk1 did indeed cause a gel shift of mylipb, which was reduced by CIP treatment (Figs 7B and S7B), suggesting that mylipb may be a substrate for the phosphokinase tbk1. To support this speculation, we examined protein-protein interactions. As shown in Fig 7C, coimmunoprecipitation assays revealed that mylipb associated with tbk1(Fig 7C), and overexpression of both HA-tbk1 and flag-tbk1 caused a gel shift of mylipb (Fig 7D and 7E). However, the gel shift of mylipb disappeared after overexpression of enzyme-inactivated tbk1 (tbk1-R47H) [63] (Figs 7F and S8). These results indicated that mylipb was a substrate for the phosphokinase tbk1. To determine the phosphorylation sites of mylipb, we performed a search in the phosphosite database (https://www.phosphosite.org/) and identified 8 conservative points of huMYLIP, including T47, S49, S149, T279, S282, T318, S319 and Y323. By homology alignment analysis, the corresponding zebrafish mylipb for these sites are T47, T49, S149, T279, S282, T318, S319 and Y323 (S9A Fig). Since huMYLIP can also be phosphorylated by huTBK1 (S9B Fig), we speculate that the phosphorylation sites they contain are evolutionarily conserved. Given that tbk1 is a serine/threonine phosphokinase, the following mutant plasmids including T47/S49A(mut1), S149A(mut2), T279/S282A(mut3) and T318/S319A(mut4) were constructed for further experiments. As shown in Fig 7G, overexpression of tbk1 caused hardly any gel shift of mylipb-mut4, suggesting that T318/S319 are the phosphorylation sites of mylipb catalyzed by tbk1. Based on these data, it is possible that the host uses mylipb to compete with cellular irf3 for phosphorylation by tbk1. As expected, immunoblot analysis showed that the presence of mylipb-C381S attenuated the shifted band of irf3, but mylipb-mut4 had no apparent effect on reducing the phosphorylation of irf3 (Fig 7H). Given that mylipb is a decoy substrate for tbk1 and that tbk1 plays a critical role in the defence against viral infection, the function of mylipb in regulating the tbk1-mediated cellular antiviral immune response was investigated. Upon SVCV infection, zebrafish mylipb-C381S interfered with the antiviral function of tbk1 in terms of both CPE and viral titer (Fig 7I–7J). In addition, the effect of tbk1 on viral gene inhibition was attenuated by mylipb (Fig 7K). For the host antiviral IFN response, the tbk1-induced upregulation of ifn and ISGs was also reversed by mylipb (Fig 7L).

These results suggest that mylipb acts as a decoy substrate to attenuate the cellular antiviral response capacity induced by phosphokinase tbk1-mediated irf3 phosphorylation.

thumbnail
Download:
Fig 7. Mylipb decreases tbk1-mediated irf3 phosphorylation and cellular antiviral response.

(A) Overexpression of mylipb-WT and mylipb-C381S inhibits tbk1-mediated phosphorylation of irf3. HEK293T cells were transfected with Flag-tbk1 and empty vector or Myc-mylipb-WT or mylipb-C381S, together with HA-irf3 for 24 h. At 24 h posttransfection, the cells were treated with 3-MA for 8 h. The lysates were then subjected to IB with the indicated Abs. (B) Mylipb interacts with tbk1. HEK293T cells seeded in 100-mm dishes were transfected with the indicated plasmids (4 μg each). After 24 h, total cell lysates were immunoprecipitated (IP) with anti-Flag antibody conjugated agarose beads. Then, the immunoprecipitates and cell lysates were detected with anti-Myc or anti-Flag Ab, respectively. (C) Overexpression of mylipb does not significantly disrupt the protein level of tbk1 in dose manner. (D-E) Tbk1 phosphorylates mylipb. HEK293T cells co-transfected with HA-tbk1 or Flag-tbk1 and empty vector together with Myc-mylipb for 24 h. The lysates were then subjected to IB with the indicated Abs. (F) Tbk1 phosphorylates mylipb dependent on its phosphokinase activity. HEK293T cells were transfected with Flag-tbk1 or Flag-tbk1-R47H (enzyme inactivated mutation) and empty vector together with Myc-mylipb for 24 h. The lysates were then subjected to IB with the indicated Abs. (G) T318/S319 is the phosphorylation sites of mylipb catalyzed by tbk1. HEK293T cells were transfected with Myc-mylipb mutants together with Flag-tbk1 or empty vector for 24 h. The lysates were then subjected to IB with the indicated Abs. (H) Mylipb-mut4(T318/S319A) has no obvious effect on phosphorylation of irf3. HEK293T cells were transfected with Flag-tbk1 and empty vector or Myc-mylipb-C381S or mylipb-mut4, together with HA-irf3 for 24 h, and then cultured in the presence of 3-MA (1 mM),or DMSO for 12 h. The lysates were then subjected to IB with the indicated Abs. (I-J) Overexpression of mylipb decreases tbk1-mediated decline of viral titer. EPC cells seeded in 12-well plates overnight were transfected with Flag-tbk1 and Myc-mylipb-C381S or empty vector. At 24 h post-transfection, cells were infected with SVCV (MOI = 1) for 48 h. Then, cells were fixed with 4% PFA and stained with 1% crystal violet (I). Culture supernatants from the cells infected with SVCV were collected, and the viral titer was measured (J). (K) Overexpression of mylipb decreases tbk1-mediated decline of copy number of SVCV genes in SVCV-infected EPC cells. EPC cells were transfected with Flag-tbk1 and Myc-mylipb-C381S or empty vector, cells were infected with SVCV (MOI of 1). After 24 h, total RNAs were extracted for examining the mRNA levels of the N, P, and G gene of SVCV by qRT-PCR analysis. Western blotting tests to detect the overexpression of mylipb and tbk1. (L) Overexpression of mylipb blocks the expression of ifn, viperin and isg15 induced by tbk1. EPC cells were transfected with Flag-tbk1 or empty vector together with Myc-mylipb-C381S or empty vector. At 24 h after transfection, total RNAs were extracted for examining the mRNA levels of the ifn, viperin, and isg15 gene of EPC cells by qRT-PCR analysis. Western blotting tests to detect the overexpression of mylipb and tbk1. All data are presented as mean values based on three repeated experiments, and error bars indicate the ± SD. *,P < 0.05, **, P<0.01; ***, P < 0.001; ****, P< 0.0001.

https://doi.org/10.1371/journal.ppat.1012227.g007

Mylipb interacts with irf7 and induces degradation of irf7

We further test if mylipb also targets irf7 and NF-κB proteins. Co-immunoprecipitation assays demonstrated that ectopically expressed mylipb pulled down irf7 but not NF-κB–p65 in HEK293T cells (S10A and S10B Fig). Overexpression of mylipb resulted in a dose-dependent reduction of overexpressed irf7 protein (S10C Fig). However, we found that irf7 degradation induced by mylipb was detectable in both wild-type (WT) cells and ATG5 KO or BECN1 KO cells (S10D Fig), suggesting that mylipb induces degradation of irf7 independent of the autophagy pathway. As shown in S10E Fig, mylipb induced the degradation of irf7 dependent of its ubiquitin ligase activity (S10E Fig). Using promoter assays, we found that overexpression of mylipb-WT suppressed the ISRE and IFN reporter induced by irf7(S10F–S10G Fig). These results suggest that mylipb also targets irf7, but is mechanistically distinct from irf3. We will investigate this further at a later stage.

Discussion

IRF3 is a transcription factor essential for innate immunity against viruses, and its protein levels and activity can be precisely regulated by post-translational modifications to effectively protect the host from infection and prevent excessive immune pathology [15,21]. In this study, we identified zebrafish mylipb as a virus-responsive gene that negatively regulates antiviral innate immunity by promoting K6-linked polyubiquitination of irf3 at lysine 352 and inhibiting tbk1-mediated phosphorylation of irf3, uncovering a novel, to our knowledge, function of mylipb of innate antiviral responses using an in vivo model (Fig 8).

thumbnail
Download:
Fig 8. A model on the two synergistic mechanisms of zebrafish mylipb in negative regulation of antiviral innate immunity.

Upon viral infection, zebrafish rig-i/mda5 recognizes the viral RNA and interacts with mavs, leading to the recruitment of tbk1, which phosphorylates irf3 and then induces IFN production. Zebrafish mylipb, an E3 ubiquitin ligase, increases K6-linked polyubiquitination at Lys 352, leading to the induction of autophagic degradation of irf3, while at the same time reducing irf3 phosphorylation by acting as a substrate for tbk1, thereby preventing the expression of IFN.

https://doi.org/10.1371/journal.ppat.1012227.g008

Ubiquitination is a post-translational modification with complex modes and diverse results [34]. It plays an important role in the vital activities by regulating the stability, activity and localization of target proteins [64]. The ubiquitin-mediated system is one of the major degradation mechanisms for the removal of abnormal and unused proteins in order to maintain intracellular protein homeostasis [65]. In addition to the classical K48-linked polyubiquitination, all non-K63-linked (including K6-, K11-, K27-, K29- and K33-linked) ubiquitination could result in proteasomal degradation of proteins [66]. Additionally, increasing evidence has shown that the ubiquitination proteins can also be degraded by the lysosomal and autophagy pathways [40,67,68]. Previous studies have shown that different ubiquitination events are involved in the regulation of IRF3 stability. RBCK1, c-Cbl and RAUL induces K48-linked polyubiquitination and degradation of IRF3 by the proteasomes, thereby repressing the expression of type I IFNs [43,44,46]. Zebrafish fbxo3 increases the K27-linked polyubiquitination of irf3 and promotes its degradation by the proteasome pathway [42]. TRIM21 and PMSD14 regulate the autophagy of IRF3 by balancing the K27-linked polyubiquitination of IRF3 [40,69]. Furthermore, even the same E3 ubiquitin ligase causes substrates to undergo different degradation pathways due to the diversity of ubiquitination types. For example, as an E3 ubiquitin ligase, MYLIP inhibits LDLR and VLDRL proteins via the ubiquitin-lysosomal pathway, while controlling its own protein levels via the ubiquitin-proteasome pathway [54, 70]. This study reports that zebrafish mylipb interacts with irf3 and catalyses the K6-linked polyubiquitination of irf3, dependent on its E3 ubiquitin ligase activity, leading to the degradation of irf3 by the autophagy pathway.

Protein undergoing K6-linked ubiquitination, resulting in different propensities to be stabilised, degraded, change in cellular localisation and ability to bind partners, etc [71,72]. The role of K6-linked ubiquitination in antiviral innate immunity is attracting the attention of researchers. It is a degradation signal for viperin and IRF7, and regulates the DNA-binding capacity of IRF3 [38,73,74]. Here, we report that K6-linked ubiquitination is an autophagy signal for irf3, revealing the functional multiplexity of K6-linked ubiquitination. The function of K6-linked ubiquitination in innate immunity has been established, but the diverse patterns of regulation and the molecular mechanisms involved remain to be elucidated.

Upon pathogen recognition, IRF3 is activated through a sequential process including phosphorylation, dimerization and nuclear translocation [21,22]. Thus, modulation of IRF3 phosphorylation usually occurs in the cytoplasm, mediated by disruption of TBK1 function [18,47]. In this study, we show that cytoplasmic mylipb associates with tbk1 and acts as a decoy substrate to attenuate tbk1-mediated irf3 phosphorylation, thereby impairing the cellular antiviral response capacity. Our data provide a synergistic mechanism for mylipb in antiviral immunity independent of its enzymatic activity. However, we do not provide sufficient evidence to suggest that zebrafish mylipb could also reduce the dimerization and nuclear translocation of irf3 after infection with SVCV.

Viral infections in fish cause huge losses in the aquaculture industry [75–77]. In this study, we find that mylipb-deficient zebrafish are more resistant to SVCV infection, but have no defects in development, growth rate and reproductive ability. These data suggest that mylipb may be a good candidate gene for the cultivation of antiviral fish strains using gene-targeting technology, which would greatly benefit the aquaculture industry.

In summary, we have mainly used the zebrafish model and cell line to demonstrate the function of mylipb acting as a suppressor in the antiviral innate immunity. Given the evolutionarily conserved activity of MYLIP between zebrafish and mammals, mammalian MYLIP may have similar function as zebrafish mylipb in response to viral infection.

Materials and methods

Ethics statement

Fish experiments in this study were conducted at the Institute of Hydrobiology, Chinese Academy of Sciences, in accordance with European Union guidelines for handling of laboratory animals (2010/63/EU). All zebrafish experiments were approved by the Institutional Animal Care and Use Committee of the Institute of Hydrobiology, Chinese Academy of Sciences (IHB-2022-039).

Cells and viruses

Zebrafish liver cells (ZFL) were grown in Ham’s F12 medium (HyClone) supplemented with 10% FBS. Epithelioma papulosum cyprini (EPC) cells were maintained in medium 199(M-199) (ViaCell Biosciences) containing 10% FBS. HEK 293T cells were maintained at 37°C containing 5% CO2, and ZFL and EPC cells were grown at 28°C containing 5% CO2. Human embryonic kidney (HEK) 293T cells were cultured in Dulbecco’s modified Eagle medium (DMEM) (ViaCell Biosciences) supplemented with 10% fetal bovine serum (FBS) (ViaCell Biosciences). All cell lines were cultured in a humidified incubator, verified to be free of Mycoplasma contamination before use. Spring viremia of carp virus (SVCV), strain OMG067 was propagated in EPC cells until the cytopathic effect (CPE) was complete, and the culture medium containing SVCV (multiplicity of infection [MOI]; 109 TCID50/mL) was collected and stored at -80°C until use.

Zebrafish

Zebrafish (Danio rerio) strain AB fish were raised, maintained, and staged according to standard protocols. CRISPR/Cas9 was used to knockout mylipb in zebrafish. First, mylipb single guide RNA (sgRNA) was designed using the CRISPR design tool (http://crispr.mit.edu). The sgRNA sequence was AGATCTACGGTCAAGACCCC. The zebrafish codon optimized Cas9 plasmid was digested with XbaI and then purified and transcribed using the T7 mMessage machine kit (Ambion). PUC9 guide RNA (gRNA) vector was used to amplify mylipb sgRNA template. The Transcript Aid T7 highyield transcription kit (Fermentas) was used to synthesize sgRNA. One-cell stage embryos were injected with 1ng Cas9 RNA and 0.15ng sgRNA per embryo. The chimeras were initially detected using a heteroduplex mobility assay (HMA) as previously described[78].If the HMA results were positive, the remaining embryos were raised to adulthood as the F0 generation and then backcrossed to WT zebrafish (strain AB) to generate the F1 generation. F1s were genotyped using HMAs. Genotypes were confirmed by target site sequencing. Heterozygous F1s were backcrossed to WT zebrafish (strain AB; parent-offspring mating prohibited) to generate the F2 generation. F2 adults carrying the target mutation were intercrossed to generate F3 offspring. The F3 generation contained WT (+/+), heterozygous (+/-), and homozygous (-/-) individuals. The primers used to identify mutants were as follows: forward primer,CTGATGCATGTGAAGGAGGA, reversed primer,GTAACGCAACTGATGCTAGG The novel mutants were named following zebrafish nomenclature guidelines: mylipbihbmb73/ ihbmb73(https://zfin.org/ZDB-ALT-230809-2). All zebrafish procedures were performed approval of the Institutional Animal Care and Use Committee (IACUC) at the Institute of Hydrobiology, Chinese Academy of Sciences.

Plasmid construction and reagents

Zebrafish gene mylipb (ENSDARG00000055118) and its truncated mutants were PCR amplified from AB zebrafish cDNA using PCR. Amplified genes were subcloned into pCMV-Myc (Clontech), pCMV-HA (Clontech), or pCMV-Flag (Clontech) vectors. These plasmids, including Myc-rig-i, Myc-mda5, Myc-tbk1, Myc-irf3, were constructed using the pCMV-Myc vector as described previously. All constructs were verified by DNA sequencing.

VigoFect (Vigorous Biotechnology, Beijing, China) and FishTrans (MST, FT2020, Wuhan, China) were used for cell transfection. poly I:C (InvivoGen, San Diego, CA) was transfected with Lipofectamine 3000 (Thermo Fisher Scientific). Cycloheximide (CHX), MG132, Baf-A1 and 3-MA were purchased from MedChem Express. NH4Cl was purchased from Sigma-Aldrich. The antibodies used were as follows: anti-Flag antibody (F1804; Sigma-Aldrich), anti-Myc antibody (9E10; Santa Cruz Biotechnology), anti-HA antibody (MMS-101R; Covance), anti-LC3 antibody (ab48394; Abcam), anti-irf3 (A11921, Abclonal), anti-phosphor-IRF3 (4947, Cell Signaling Technology). anti-ATG5 (A0203, ABclonal), anti-BECN1 (A17028, ABclonal), anti-α-tubulin (62204, Thermo Fisher Scientific), anti-GAPDH antibody (AC033; ABclonal) and anti-β-actin antibody (AC026; ABclonal).

Virus infection and plaque assay

For examining gene expression of zebrafish larvae, 30 larvae (3 dpf) were pooled in a disposable 60-mm cell culture dish filled with 5 mL of egg water and 0.5 mL of SVCV (∼2.5×107TCID50/ml) solution at 28°C for 24 h. The total RNA was extracted, and quantitative real-time PCR (qRT-PCR) assays were conducted. For survival ratio assays, zebrafish larvae were placed in 96-well plates individually, and then 100μL of egg water containing SVCV (5 mL of egg water plus 2 mL of SVCV (∼2.5×107TCID50/ml) was added to each well). The survival ratio was monitored every 1 h over a 24 h period. For viral injection of adult zebrafish, zebrafish (3mpf) were intraperitoneally (i.p.) injected with SVCV(∼2.5×107TCID50/ml) at 10 μL per individual. Zebrafish i.p. injection with M-199 cell culture medium was used as the control. The survival ratio was monitored every 12 h over a 108 h period.

For the plaque assay, EPC cells were transfected with 2 μg of Myc- mylipb or pCMV-Myc vector. After 24 h, cells were infected with SVCV for 48 h at the dose indicated. Subsequently, the supernatant was collected from EPC cells infected with SVCV (multiplicity of infection [MOI] of 1) for the detection of virus titers, and the cells were washed with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde, and stained with 1% crystal violet for visualizing CPE.

Virus titer determination

EPC cells were cultured in 96-well plates. The culture supernatant (containing virus) was diluted in serial dilutions (10−1 to 10−11) in sterile 1.5 mL tubes using M-199 medium. Subsequently, the diluted viruses were added to EPC cells seeded into 96-well plates. After 4 days, the plates were observed under a microscope, and the area of detached cells after infection with virus. 50% in one well were counted as positive. The titers for SVCV infection were calculated using the Spearman-Kärber method and represented as 50% tissue culture-infective dose (TCID50) assay. The experiments were repeated three times for statistical analysis.

Luciferase reporter assays

EPC cells were grown in 24-well plates and transfected with the indicated plasmids, as well as with CMV-Renilla used as a control. The ratio between the luciferase reporters (ISRE-Luc, Dr-IFNφ1-Luc, or EPC-IFN-Luc) and CMV-Renilla was 10:1, and pCMV-Myc vector was used to ensure equivalent amounts of total DNA in each well. After the cells were transfected for 24–48 h, the luciferase activity was determined by the dual-luciferase reporter assay system (Promega). Data were normalized to Renilla luciferase. Data are representative of three independent experiments (mean ± SD).

Quantitative real-time PCR (qRT-PCR) analysis

Total RNA was extracted from cells, larvae (n = 30), using the RNAiso Plus kit (TaKaRa Bio, Beijing, China), following the manufacturer’s instructions. Equivalent amounts of total RNA (2ug) were used for cDNA synthesis with the RevertAid first-strand cDNA synthesis kit (Thermo Scientific, Waltham, MA, USA). MonAmp SYBR green qPCR mix (high Rox) (Monad Bio, Shanghai, China) was used for qRT-PCR assays. Each experiment was repeated at least three times independently. The primers for qRT-PCR assays are listed in S1 Table.

Immunoprecipitation assay and Western blot

Anti-Flag antibody, anti-Myc antibody and anti-HA antibody-conjugated agarose beads were purchased from Sigma-Aldrich. The experimental procedures including Western blot and coimmunoprecipitation analysis have been described previously [79]. The Fuji Film LAS4000 mini luminescent image analyzer was used for photographing the blots. Multigauge V3.0 was used for quantifying the protein levels based on the band density obtained in the Western blot analysis.

Immunofluorescence confocal microscopy

HEK293T cells grown on glass coverslips were fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.1% Triton X-100, and blocked with 1% bovine serum albumin (BSA). Then, the cells were stained with the indicated primary antibodies followed by incubation with fluorescent-dye-conjugated secondary antibodies. Nuclei were counterstained with DAPI (4,6-diamidino-2-phenylindole; Sigma-Aldrich). Imaging of the cells was carried out using a Leica laser-scanning confocal microscope.

Ubiquitination assay

HEK 293T cells seeded in 100-mm dishes were transfected with Flag-irf3 or HA-irf3, Myc-mylipb, or empty vector, together with His-ubiquitin or its mutants. At 24 h posttransfection, the cells were treated with 3-MA for 8 h. Transfected cells were washed twice with 2 ml ice-cold PBS and then digested with 1 ml 0.25% trypsin-EDTA for 3 min until the cells were dislodged. Cells were resuspended into 1.5 ml EP tube with 1ml PBS, centrifuged at 1000rpm for 3 min, and then the supernatant was removed. The cells were lysed using guanidinium chloride, and purifified with Ni2+-NTA agarose overnight at 4°C with constant agitation. These samples were further analyzed by immunoblotting. Ubiquitination assay of irf3 in zebrafish liver: mylipb-null zebrafish (3 mpf) and their WT siblings (3 mpf) were i.p. injected with (+) or without (-) SVCV(∼2.50 × 107 TCID50/mL) at 10 μl/individual for 48 h, then their livers were dissected, and lysed with lysis buffer (100 μl). The supernatants were denatured at 95°C for 5 min in the presence of 1% SDS. The denatured lysates were diluted with lysis buffer to reduce the concentration of SDS (<0.1%). Denature-IP was conducted using anti-irf3 antibody and then subjected to immunoblotting with anti-Ubiquitin antibody.

Statistical analysis

The statistical analysis was performed using GraphPad Prism version 8.0 (unpaired t tests). Data are representative of at least three independent experiments, and error bars indicate the mean with SD. For zebrafish survival analysis, the Kaplan-Meier method was adopted to generate graphs, and the survival curves were analyzed by log-rank analysis. A p value <0.05 was considered significant. Statistical significance is represented as follows: *p <0.05; **p<0.01; ***p<0.001; ****p< 0.0001.

Supporting information

S1 Fig. The generation of mylipb-null zebrafish via CRISPR/Cas9 techniques.

(A) The schematic of the targeting site in mylipb and the resulting nucleotide sequence in the mutant (MT, mylipbihbmb73/ ihbmb73).The predicted protein product of maoc1 in the mutant and wild-type (WT) sibling. (B) Verification of the efficiency of CRISPR/Cas9-mediated zebrafish mylipb disruption by heteroduplex mobility assay (HMA). (C) The relative mRNA levels of mylipb in the WT and homozygous mutant. All data are presented as mean values based on three repeated experiments, and error bars indicate the ± SD. *,P < 0.05, **, P<0.01; ***, P < 0.001; ****, P< 0.0001

https://doi.org/10.1371/journal.ppat.1012227.s001

(TIF)

S2 Fig. Mylipb induces inflammation factor expression in SVCV infection.

(A) Induction of genes downstream of NF-kB, including il-1β, il8, tnfα, was decreased in mylipb-/- larvae compared with WT larvae (mylipb+/+) after SVCV infection. 30 larvae (3 dpf) were pooled in a disposable 60-mm cell culture dish filled with 5 mL of egg water and 0.5 mL of SVCV (∼2.5×107TCID50/ml) solution at 28°C for 24h. (B) Overexpression of mylipb suppressed expression of il-1β, il8 and tnfα induced by SVCV infection in EPC cells. EPC cells were transfected with Myc-mylipb or empty vector for 24 h and infected with SVCV (MOI: 1). After 24 h, total RNAs were extracted for examining the mRNA levels of il-1β, il8 and tnfα by qRT-PCR analysis.

https://doi.org/10.1371/journal.ppat.1012227.s002

(TIF)

S3 Fig. Mylipb interacts with irf3 and induces autophagic degradation of irf3.

Related to Fig 4.(A) Mylipb associated with irf3. HEK293T cells seeded in 100-mm dishes were transfected with the indicated plasmids (4 μg each). After 24 h, total cell lysates were immunoprecipitated (IP) with anti-HA antibody conjugated agarose beads. Then, the immunoprecipitates and cell lysates were detected with anti-HA or anti-Flag Ab, respectively. (B, C) Wild-type (WT), ATG5 and BECN1 knockout (KO) 293T cells were co-transfected with Myc-mylipb and HA-irf3 for 24 h. The cell lysates were subjected to western blotting with the indicated antibodies.

https://doi.org/10.1371/journal.ppat.1012227.s003

(TIF)

S4 Fig.

(A) Amino acid sequence alignment of human MYLIP and zebrafish mylipb.

https://doi.org/10.1371/journal.ppat.1012227.s004

(TIF)

S5 Fig. Mylipb negatively regulates irf3 by promoting K6-linkd ubquitination of irf3.

Related to Fig 5. (A) Mylipb promoted irf3 ubiquitination depended on ZF domain and ubiquitin ligase activity of mylipb. HEK 293T cells were transfected with Flag-irf3, Myc-mylipb-WT, Myc-mylipb-1-279, Myc-mylipb-1-380, Myc-mylipb-1-416, Myc-mylipb-Δ381–416, or empty vector, together with His-ubiquitin. At 24 h posttransfection, the cells were treated with 3-MA for 8 h. The cells were lysed using guanidinium chloride, and purifified with Ni2+-NTA agarose. (B) Mylipb promoted irf3 K6-linked ubiquitination. HEK293T cells were transfected with Flag-irf3, Myc-mylipb, or empty vector, together with His-K6R ubiquitin. At 24 h posttransfection, the cells were treated with 3-MA for 8 h. The cells were lysed using guanidinium chloride, and purifified with Ni2+-NTA agarose.

https://doi.org/10.1371/journal.ppat.1012227.s005

(TIF)

S6 Fig.

(A) Amino acid sequence alignment of human IRF3, mouse Irf3, zebrafish irf3. (B) MYLIP induced degradation of IRF3. HEK293T cells co-transfected with Myc-IRF3 and empty vector together with HA-IRF3 for 24 h. The lysates were then subjected to IB with the indicated Abs.

https://doi.org/10.1371/journal.ppat.1012227.s006

(TIF)

S7 Fig. Mylipb decreases tbk1-mediated irf3 phosphorylation.

Related to Fig 7. (A-B) The amount of tbk1-phosphorylated irf3(A) and mylipb(B) were reduced by CIP treatment. Cells were transfected with the indicated plasmids (1 μg each) for 24 h. Then the cell lysates (100 μL) were treated with or without CIP (10 U) for 30 min at 37°C. Then the lysates were detected by IB with the indicated Abs.

https://doi.org/10.1371/journal.ppat.1012227.s007

(TIF)

S8 Fig.

(A) Homology alignment analysis show that the corresponding zebrafish tbk1 for R47 of human TBK1 is R47.

https://doi.org/10.1371/journal.ppat.1012227.s008

(TIF)

S9 Fig.

(A) Amino acid sequence alignment of human MYLIP, mouse Mylip, zebrafish mylipb. (B) TBK1 phosphorylates MYLIP. HEK293T cells co-transfected with HA-TBK1 and empty vector together with Myc-MYLIP for 24 h. The lysates were then subjected to IB with the indicated Abs.

https://doi.org/10.1371/journal.ppat.1012227.s009

(TIF)

S10 Fig. Mylipb interacts with irf7 and induces degradation of irf7.

(A) Mylipb don’t associated with p65. HEK293T cells seeded in 100-mm dishes were transfected with the indicated plasmids (4 μg each). After 24 h, total cell lysates were immunoprecipitated (IP) with anti-Flag antibody conjugated agarose beads. Then, the immunoprecipitates and cell lysates were detected with anti-Myc or anti-Flag Ab, respectively. (B) Mylipb associated with irf7. HEK293T cells seeded in 100-mm dishes were transfected with the indicated plasmids (4 μg each). After 24 h, total cell lysates were immunoprecipitated (IP) with anti-Flag antibody conjugated agarose beads. Then, the immunoprecipitates and cell lysates were detected with anti-HA or anti-Flag Ab, respectively. (C) Mylipb induced the degradation of irf7 in a dose-dependent manner. HEK293T cells were transfected with Myc-empty, Myc-mylipb, and Flag-irf7 for 24 h, and then the cells were harvested to perform immunoblotting. (D) Wild-type (WT), ATG5 and BECN1 knockout (KO) 293T cells were co-transfected with Myc-mylipb and Flag-irf7 for 24 h. The cell lysates were subjected to western blotting with the indicated antibodies. (E) Mylipb induced the degradation of irf7 dependent of its ubiquitin ligase activity. HEK293T cells were transfected with Myc-mylipb-WT or Myc-mylipb-C381S, together with HA-irf7 for 24 h. The lysates were then subjected to IB with the indicated Abs. (F-G) Overexpression of mylipb-WT, but not mylipb-C381S suppressed the activity of ISRE reporter (F), EPC IFN reporter (G), induced by irf7.

https://doi.org/10.1371/journal.ppat.1012227.s010

(TIF)

S1 Table. The primer sequences.

https://doi.org/10.1371/journal.ppat.1012227.s011

(DOCX)

S1 Data. Excel spreadsheet containing, in separate sheets, the underlying numerical data for Figs.

https://doi.org/10.1371/journal.ppat.1012227.s012

(XLSX)

S2 Data. File containing the original uncropped pictures for Figs.

https://doi.org/10.1371/journal.ppat.1012227.s013

(PDF)

S3 Data. File containing the original uncropped photos for Fig 2.

https://doi.org/10.1371/journal.ppat.1012227.s014

(DOCX)

Acknowledgments

We are grateful to Dr. Jun Cui (School of Life Sciences, Sun Yat-sen University) for providing Knockout cell lines (ATG5KO and BECN1 KO) and Guangxin Wang (Analysis and Testing Center, IHB, CAS) for her help with fluorescent microscope analysis.

References

  1. 1. McNab F, Mayer-Barber K, Sher A, Wack A, O’Garra A. Type I interferons in infectious disease. Nature reviews Immunology. 2015;15(2):87–103. pmid:25614319
  2. 2. Brubaker SW, Bonham KS, Zanoni I, Kagan JC. Innate immune pattern recognition: a cell biological perspective. Annual review of immunology. 2015;33:257–90. pmid:25581309
  3. 3. Chen SN, Zou PF, Nie P. Retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) in fish: current knowledge and future perspectives. Immunology. 2017;151(1):16–25. pmid:28109007
  4. 4. Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell. 2006;124(4):783–801. pmid:16497588
  5. 5. Cao X. Self-regulation and cross-regulation of pattern-recognition receptor signalling in health and disease. Nature reviews Immunology. 2016;16(1):35–50. pmid:26711677
  6. 6. Kawai T, Akira S. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nature immunology. 2010;11(5):373–84. pmid:20404851
  7. 7. Kawai T, Akira S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity. 2011;34(5):637–50. pmid:21616434
  8. 8. O’Neill LA, Golenbock D, Bowie AG. The history of Toll-like receptors—redefining innate immunity. Nature reviews Immunology. 2013;13(6):453–60. pmid:23681101
  9. 9. Chen Q, Sun L, Chen ZJ. Regulation and function of the cGAS-STING pathway of cytosolic DNA sensing. Nature immunology. 2016;17(10):1142–9. pmid:27648547
  10. 10. Bruns AM, Horvath CM. Activation of RIG-I-like receptor signal transduction. Critical reviews in biochemistry and molecular biology. 2012;47(2):194–206. pmid:22066529
  11. 11. Chang M, Collet B, Nie P, Lester K, Campbell S, Secombes CJ, et al. Expression and functional characterization of the RIG-I-like receptors MDA5 and LGP2 in Rainbow trout (Oncorhynchus mykiss). Journal of virology. 2011;85(16):8403–12. pmid:21680521
  12. 12. Gong X-Y, Zhang Q-M, Zhao X, Li Y-L, Qu Z-L, Li Z, et al. LGP2 is essential for zebrafish survival through dual regulation of IFN antiviral response. iScience. 2022;25(8). pmid:35982787
  13. 13. Rehwinkel J, Gack MU. RIG-I-like receptors: their regulation and roles in RNA sensing. 2020;20(9):537–51.
  14. 14. Chan YK, Gack MU. Viral evasion of intracellular DNA and RNA sensing. Nat Rev Microbiol. 2016;14(6):360–73. pmid:27174148
  15. 15. Liu S, Cai X, Wu J, Cong Q, Chen X, Li T, et al. Phosphorylation of innate immune adaptor proteins MAVS, STING, and TRIF induces IRF3 activation. Science (New York, NY). 2015;347(6227):aaa2630.
  16. 16. DeFilippis VR, Kong Z, Yin H, Wang F, Liu Z, Luan X, et al. Pseudorabies virus tegument protein UL13 recruits RNF5 to inhibit STING-mediated antiviral immunity. PLOS Pathogens. 2022;18(5).
  17. 17. Zhang J, Zhang YB, Wu M, Wang B, Chen C, Gui JF. Fish MAVS is involved in RLR pathway-mediated IFN response. Fish & shellfish immunology. 2014;41(2):222–30. pmid:25219369
  18. 18. Fitzgerald KA, McWhirter SM, Faia KL, Rowe DC, Latz E, Golenbock DT, et al. IKKε and TBK1 are essential components of the IRF3 signaling pathway. Nature immunology. 2003;4(5):491–6.
  19. 19. Zhu J, Chiang C, Gack MU. Viral evasion of the interferon response at a glance. J Cell Sci. 2023;136(12). pmid:37341132
  20. 20. Sun F, Zhang YB, Liu TK, Shi J, Wang B, Gui JF. Fish MITA serves as a mediator for distinct fish IFN gene activation dependent on IRF3 or IRF7. Journal of immunology (Baltimore, Md: 1950). 2011;187(5):2531–9. pmid:21795596
  21. 21. Tamura T, Yanai H, Savitsky D, Taniguchi T. The IRF family transcription factors in immunity and oncogenesis. Annual review of immunology. 2008;26:535–84. pmid:18303999
  22. 22. Taniguchi T, Ogasawara K, Takaoka A, Tanaka N. IRF family of transcription factors as regulators of host defense. Annual review of immunology. 2001;19:623–55. pmid:11244049
  23. 23. Sun F, Zhang Y-B, Liu T-K, Gan L, Yu F-F, Liu Y, et al. Characterization of Fish IRF3 as an IFN-Inducible Protein Reveals Evolving Regulation of IFN Response in Vertebrates. The Journal of Immunology. 2010;185(12):7573–82. pmid:21084665
  24. 24. Chiang C, Gack MU. Post-translational Control of Intracellular Pathogen Sensing Pathways. Trends in immunology. 2017;38(1):39–52. pmid:27863906
  25. 25. Deribe YL, Pawson T, Dikic I. Post-translational modifications in signal integration. Nature structural & molecular biology. 2010;17(6):666–72. pmid:20495563
  26. 26. Liu J, Qian C, Cao X. Post-Translational Modification Control of Innate Immunity. Immunity. 2016;45(1):15–30. pmid:27438764
  27. 27. Vazquez C, Jurado KA. Neurotropic RNA Virus Modulation of Immune Responses within the Central Nervous System. Int J Mol Sci. 2022;23(7). pmid:35409387
  28. 28. Zhao J, Zeng Y, Xu S, Chen J, Shen G, Yu C, et al. A Viral Deamidase Targets the Helicase Domain of RIG-I to Block RNA-Induced Activation. Cell host & microbe. 2016;20(6):770–84. pmid:27866900
  29. 29. Bhoj VG, Chen ZJ. Ubiquitylation in innate and adaptive immunity. Nature. 2009;458(7237):430–7. pmid:19325622
  30. 30. Chen ZJ. Ubiquitination in signaling to and activation of IKK. Immunological reviews. 2012;246(1):95–106. pmid:22435549
  31. 31. Davis ME, Gack MU. Ubiquitination in the antiviral immune response. Virology. 2015;479–480:52–65. pmid:25753787
  32. 32. Heaton SM, Borg NA, Dixit VM. Ubiquitin in the activation and attenuation of innate antiviral immunity. The Journal of experimental medicine. 2016;213(1):1–13. pmid:26712804
  33. 33. Liu Y, Qin C, Rao Y, Ngo C, Feng JJ, Zhao J, et al. SARS-CoV-2 Nsp5 Demonstrates Two Distinct Mechanisms Targeting RIG-I and MAVS To Evade the Innate Immune Response. mBio. 2021;12(5):e0233521. pmid:34544279
  34. 34. Hershko A, Ciechanover A. The ubiquitin system. Annual review of biochemistry. 1998;67:425–79. pmid:9759494
  35. 35. Jiang X, Chen ZJ. The role of ubiquitylation in immune defence and pathogen evasion. Nature reviews Immunology. 2011;12(1):35–48. pmid:22158412
  36. 36. Swatek KN, Komander D. Ubiquitin modifications. Cell research. 2016;26(4):399–422. pmid:27012465
  37. 37. Zheng Y, Liu Q, Wu Y, Ma L, Zhang Z, Liu T, et al. Zika virus elicits inflammation to evade antiviral response by cleaving cGAS via NS1-caspase-1 axis. The EMBO journal. 2018;37(18). pmid:30065070
  38. 38. Zhang Z, Wang D, Wang P, Zhao Y, You F. OTUD1 Negatively Regulates Type I IFN Induction by Disrupting Noncanonical Ubiquitination of IRF3. The Journal of Immunology. 2020;204(7):1904–18. pmid:32075857
  39. 39. Gao L, Wang L, Dai T, Jin K, Zhang Z, Wang S, et al. Tumor-derived exosomes antagonize innate antiviral immunity. Nature immunology. 2018;19(3):233–45. pmid:29358709
  40. 40. Wu Y, Jin S, Liu Q, Zhang Y, Ma L, Zhao Z, et al. Selective autophagy controls the stability of transcription factor IRF3 to balance type I interferon production and immune suppression. Autophagy. 2021;17(6):1379–92. pmid:32476569
  41. 41. Lei C-Q, Zhang Y, Xia T, Jiang L-Q, Zhong B, Shu H-B. FoxO1 Negatively Regulates Cellular Antiviral Response by Promoting Degradation of IRF3. Journal of Biological Chemistry. 2013;288(18):12596–604. pmid:23532851
  42. 42. Li Z, Fan S, Wang J. Zebrafish F-box Protein fbxo3 Negatively Regulates Antiviral Response through Promoting K27-Linked Polyubiquitination of the Transcription Factors irf3 and irf7. 2020;205(7):1897–908.
  43. 43. Yu Y, Hayward GS. The Ubiquitin E3 Ligase RAUL Negatively Regulates Type I Interferon through Ubiquitination of the Transcription Factors IRF7 and IRF3. Immunity. 2010;33(6):863–77. pmid:21167755
  44. 44. Zhao X, Zhu H, Yu J, Li H, Ge J, Chen W. c-Cbl-mediated ubiquitination of IRF3 negatively regulates IFN-β production and cellular antiviral response. Cellular Signalling. 2016;28(11):1683–93.
  45. 45. Zhou Z, Cai X, Zhu J, Li Z, Yu G, Liu X, et al. Zebrafish otud6b Negatively Regulates Antiviral Responses by Suppressing K63-Linked Ubiquitination of irf3 and irf7. The Journal of Immunology. 2021;207(1):244–56. pmid:34183367
  46. 46. Zhang M, Tian Y, Wang RP, Gao D, Zhang Y, Diao FC, et al. Negative feedback regulation of cellular antiviral signaling by RBCK1-mediated degradation of IRF3. Cell research. 2008;18(11):1096–104. pmid:18711448
  47. 47. Li S, Lu L-F, Wang Z-X, Lu X-B, Chen D-D, Nie P, et al. The P Protein of Spring Viremia of Carp Virus Negatively Regulates the Fish Interferon Response by Inhibiting the Kinase Activity of TANK-Binding Kinase 1. Journal of virology. 2016;90(23):10728–37. pmid:27654289
  48. 48. Calkin AC, Goult BT, Zhang L, Fairall L, Hong C, Schwabe JW, et al. FERM-dependent E3 ligase recognition is a conserved mechanism for targeted degradation of lipoprotein receptors. Proceedings of the National Academy of Sciences of the United States of America. 2011;108(50):20107–12. pmid:22109552
  49. 49. Martinelli L, Adamopoulos A, Johansson P, Wan PT, Gunnarsson J, Guo H, et al. Structural analysis of the LDL receptor-interacting FERM domain in the E3 ubiquitin ligase IDOL reveals an obscured substrate-binding site. The Journal of biological chemistry. 2020;295(39):13570–83. pmid:32727844
  50. 50. Sorrentino V, Scheer L, Santos A, Reits E, Bleijlevens B, Zelcer N. Distinct functional domains contribute to degradation of the low density lipoprotein receptor (LDLR) by the E3 ubiquitin ligase inducible Degrader of the LDLR (IDOL). The Journal of biological chemistry. 2011;286(34):30190–9. pmid:21734303
  51. 51. Choi J, Gao J, Kim J, Hong C, Kim J, Tontonoz P. The E3 ubiquitin ligase Idol controls brain LDL receptor expression, ApoE clearance, and Aβ amyloidosis. Sci Transl Med. 2015;7(314):314ra184.
  52. 52. Hong C, Marshall Stephanie M, McDaniel Allison L, Graham M, Layne Joseph D, Cai L, et al. The LXR–Idol Axis Differentially Regulates Plasma LDL Levels in Primates and Mice. Cell Metabolism. 2014;20(5):910–8. pmid:25440061
  53. 53. Lee SD, Priest C, Bjursell M, Gao J, Arneson DV, Ahn IS, et al. IDOL regulates systemic energy balance through control of neuronal VLDLR expression. 2019;1(11):1089–100.
  54. 54. Li W, Song B, Luo J. The role and mechanism of ubiquitin ligase IDOL in cholesterol metabolism. SCIENTIA SINICA Vitae. 2021;51(11):1485–92.
  55. 55. Zelcer N, Hong C, Boyadjian R, Tontonoz P. LXR regulates cholesterol uptake through Idol-dependent ubiquitination of the LDL receptor. Science (New York, NY). 2009;325(5936):100–4. pmid:19520913
  56. 56. Wang JQ, Lin ZC, Li LL, Zhang SF, Li WH, Liu W, et al. SUMOylation of the ubiquitin ligase IDOL decreases LDL receptor levels and is reversed by SENP1. The Journal of biological chemistry. 2021;296:100032. pmid:33154164
  57. 57. Nelson JK, Sorrentino V, Avagliano Trezza R, Heride C, Urbe S, Distel B, et al. The Deubiquitylase USP2 Regulates the LDLR Pathway by Counteracting the E3-Ubiquitin Ligase IDOL. Circulation Research. 2016;118(3):410–9. pmid:26666640
  58. 58. Gitlin L, Barchet W, Gilfillan S, Cella M, Beutler B, Flavell RA, et al. Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(22):8459–64. pmid:16714379
  59. 59. Liu X, Cai X, Zhang D, Xu C, Xiao W. Zebrafish foxo3b Negatively Regulates Antiviral Response through Suppressing the Transactivity of irf3 and irf7. Journal of immunology (Baltimore, Md: 1950). 2016;197(12):4736–49. pmid:27815423
  60. 60. Song Y, Fan S, Zhang D, Li J, Li Z, Li Z, et al. Zebrafish maoc1 Attenuates Spring Viremia of Carp Virus Propagation by Promoting Autophagy-Lysosome-Dependent Degradation of Viral Phosphoprotein. Journal of virology. 2023;97(2):e0133822. pmid:36744960
  61. 61. Lu L-F, Li S, Lu X-B, Zhang Y-A. Functions of the two zebrafish MAVS variants are opposite in the induction of IFN1 by targeting IRF7. Fish & shellfish immunology. 2015;45(2):574–82. pmid:25989622
  62. 62. Gong XY, Zhang QM, Gui JF, Zhang YB. SVCV infection triggers fish IFN response through RLR signaling pathway. Fish & shellfish immunology. 2019;86:1058–63. pmid:30593899
  63. 63. Freischmidt A, Wieland T, Richter B, Ruf W, Schaeffer V, Müller K, et al. Haploinsufficiency of TBK1 causes familial ALS and fronto-temporal dementia. Nature Neuroscience. 2015;18(5):631–6. pmid:25803835
  64. 64. Chen ZJ, Sun LJ. Nonproteolytic functions of ubiquitin in cell signaling. Molecular cell. 2009;33(3):275–86. pmid:19217402
  65. 65. Morreale FE, Walden H. Types of Ubiquitin Ligases. Cell. 2016;165(1):248-.e1.
  66. 66. Xu P, Duong DM, Seyfried NT, Cheng D, Xie Y, Robert J, et al. Quantitative Proteomics Reveals the Function of Unconventional Ubiquitin Chains in Proteasomal Degradation. Cell. 2009;137(1):133–45. pmid:19345192
  67. 67. Hong C, Duit S, Jalonen P, Out R, Scheer L, Sorrentino V, et al. The E3 ubiquitin ligase IDOL induces the degradation of the low density lipoprotein receptor family members VLDLR and ApoER2. The Journal of biological chemistry. 2010;285(26):19720–6. pmid:20427281
  68. 68. Scotti E, Calamai M, Goulbourne CN, Zhang L, Hong C, Lin RR, et al. IDOL stimulates clathrin-independent endocytosis and multivesicular body-mediated lysosomal degradation of the low-density lipoprotein receptor. Molecular and cellular biology. 2013;33(8):1503–14. pmid:23382078
  69. 69. Kimura T, Jain A, Choi SW, Mandell MA, Johansen T, Deretic V. TRIM-directed selective autophagy regulates immune activation. Autophagy. 2017;13(5):989–90. pmid:26983397
  70. 70. Lindholm D, Bornhauser BC, Korhonen L. Mylip makes an Idol turn into regulation of LDL receptor. Cellular and Molecular Life Sciences. 2009;66(21):3399–402. pmid:19688294
  71. 71. Michel MA, Swatek KN, Hospenthal MK, Komander D. Ubiquitin Linkage-Specific Affimers Reveal Insights into K6-Linked Ubiquitin Signaling. Molecular cell. 2017;68(1):233–46.e5. pmid:28943312
  72. 72. Hussain M, Mohammed A, Saifi S, Priya S, Sengupta S. Hyperubiquitylation of DNA helicase RECQL4 by E3 ligase MITOL prevents mitochondrial entry and potentiates mitophagy. Journal of Biological Chemistry. 2023;299(9). pmid:37495109
  73. 73. Ji L, Wang N, Ma J, Cheng Y, Wang H, Sun J, et al. Porcine deltacoronavirus nucleocapsid protein species-specifically suppressed IRF7-induced type I interferon production via ubiquitin-proteasomal degradation pathway. Veterinary Microbiology. 2020;250. pmid:32992291
  74. 74. Yuan Y, Miao Y, Qian L, Zhang Y, Liu C, Liu J, et al. Targeting UBE4A Revives Viperin Protein in Epithelium to Enhance Host Antiviral Defense. Molecular cell. 2020;77(4):734–47.e7. pmid:31812350
  75. 75. Ahne W, Bjorklund HV, Essbauer S, Fijan N, Kurath G, Winton JR. Spring viremia of carp (SVC). Diseases of aquatic organisms. 2002;52(3):261–72. pmid:12553453
  76. 76. Ashraf U, Lu Y, Lin L, Yuan J, Wang M, Liu X. Spring viraemia of carp virus: recent advances. The Journal of general virology. 2016;97(5):1037–51. pmid:26905065
  77. 77. Rao Y, Su J. Insights into the Antiviral Immunity against Grass Carp (Ctenopharyngodon idella) Reovirus (GCRV) in Grass Carp. Journal of Immunology Research. 2015;2015:1–18.
  78. 78. Chen X, Fan S, Zhu C, Liao Q, Tang J, Yu G, et al. Zebrafish sirt5 Negatively Regulates Antiviral Innate Immunity by Attenuating Phosphorylation and Ubiquitination of mavs. Journal of immunology (Baltimore, Md: 1950). 2022;209(6):1165–72. pmid:36002231
  79. 79. Liao Q, Zhu C, Sun X, Wang Z, Chen X, Deng H, et al. Disruption of sirtuin 7 in zebrafish facilitates hypoxia tolerance. The Journal of biological chemistry. 2023;299(8):105074. pmid:37481210