Stable introduction of Wolbachia wPip into invasive Anopheles stephensi for potential malaria control

Yongkang Liang; Julian Liu; YiLian Wu; Yu Wu; Zhiyong Xi

doi:10.1371/journal.pntd.0012523

Abstract

The spread and invasion of the urban malaria vector Anopheles stephensi has emerged as a significant threat to ongoing malaria control and elimination efforts, particularly in Africa. The successful use of the maternally inherited endosymbiotic bacterium Wolbachia for arbovirus control has inspired the exploration of similar strategies for managing malaria vectors, necessitating the establishment of a stable Wolbachia-Anopheles symbiosis. In this study, we successfully transferred Wolbachia wPip into An. stephensi, resulting in the establishment of a stable transinfected HP1 line with 100% maternal transmission efficiency. We demonstrate that wPip in the HP1 line induces nearly complete unidirectional cytoplasmic incompatibility (CI) and maintains high densities in both somatic and germline tissues. Despite a modest reduction in lifespan and female reproductive capacity, our results suggest the Wolbachia infection in the HP1 line has little impact on life history traits, body size, and male mating competitiveness, as well as the ability of its larvae to tolerate rearing temperatures up to 38°C, although wPip densities moderately decrease when larvae are exposed to a constant 33°C and diurnal cyclic temperatures of 27–36°C and 27–38°C. These findings highlight the potential of the HP1 line as a robust candidate for further development in malaria control.

Author summary

Recent efforts have successfully utilized the endosymbiotic bacterium Wolbachia to control mosquito-transmitted viral diseases like dengue in multiple countries. However, similar initiatives have been limited in combating malaria, the most devastating and deadly mosquito-borne disease, which claims over half a million lives each year. This is primarily due to the difficulty in establishing a stable, maternally inheritable Wolbachia infection in Anopheles, the mosquito vector responsible for malaria transmission. A significant concern in malaria control is the invasion of the urban malaria vector Anopheles stephensi into Africa, where malaria burden is highest, and over 40% of the population resides in urban areas. Building on the previous breakthrough of establishing Wolbachia strain wAlbB in An. stephensi, the author has now achieved a second stable infection by transferring the wPip strain from Culex pipiens into this mosquito species using embryonic microinjection. The resultant transinfected HP1 line induces nearly complete cytoplasmic incompatibility when crossed with wild mosquitoes, displays robust fitness and male mating competitiveness, and exhibits strong resilience against heat stress. These advantageous traits position the HP1 line as a promising candidate for further development in malaria control.

Citation: Liang Y, Liu J, Wu Y, Wu Y, Xi Z (2024) Stable introduction of Wolbachia wPip into invasive Anopheles stephensi for potential malaria control. PLoS Negl Trop Dis 18(9): e0012523. https://doi.org/10.1371/journal.pntd.0012523

Editor: Gordana Rasic, QIMR Berghofer Medical Research Institute, AUSTRALIA

Received: April 24, 2024; Accepted: September 9, 2024; Published: September 26, 2024

Copyright: © 2024 Liang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All data are available in the manuscript and its Supporting Information files.

Funding: This work was supported by the National Natural Science Foundation of China (nos. 31372263 to YW) and the National Institutes of Health (R01AI182096 to ZX). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: I have read the journal’s policy and the authors of this manuscript have the following competing interests: YKL, JLL, YLW and ZYX are affiliated with Guangzhou Wolbaki Biotech Co., Ltd. The other authors declare no competing interests.

Introduction

Malaria, caused by Plasmodium spp., which are transmitted by Anopheles mosquito species [1], imposes a significant public health burden [2]. The World Health Organization reported approximately 249 million malaria cases and 608,000 related deaths across 85 endemic countries in 2022, a substantial increase from pre-COVID-19 pandemic estimates [3]. Despite the availability of artemisinin-based treatments, the emergence and spread of resistant Plasmodium strains and the absence of an effective vaccine have significantly hindered the global malaria eradication efforts [4–6]. Anopheles stephensi, capable of thriving in urban and man-made environments and transmitting both P. falciparum and P. vivax [7,8], is native to South Asia and parts of the Arabian Peninsula but has recently expanded its range into sub-Saharan Africa. This region, where malaria’s burden is most severe and over 40% of the population resides in urban areas, has become a critical focus for mosquito control efforts. A recent WHO initiative underscores the urgency of developing innovative control strategies targeting An. stephensi [9]. Currently, control efforts primarily rely on chemical pesticides; however, the rapid development of resistance among vectors and the adverse environmental impacts of these insecticides [10,11], necessitate the development of new methods for vector control.

The maternally transmitted endosymbiotic bacterium Wolbachia pipientis naturally infects ~40% of all terrestrial insect species [12]. Native Wolbachia infections have been discovered in several anopheline populations across Africa [13–17]. Unfortunately, except for one report of high-density infection [16,18], other native Wolbachia infections have been reported with low prevalence and low titer, which has led to controversy, as these could reasonably result from contamination or other environmental sources. Also, none of these strains has been observed to induce cytoplasmic incompatibility (CI), the early embryonic death that occurs when infected males mate with females that are either uninfected or infected with a different Wolbachia strain [19]. Stable, artificial Wolbachia infections can be generated in mosquitoes through embryo microinjection. Although many Wolbachia-transinfected Aedes lines have been developed through this technique, thus far only a single Wolbachia transinfected anopheline line has been generated: the An. stephensi LB1 line carrying wAlbB strain originally from Aedes albopictus [20]. Stable transinfections typically cause CI in mosquitoes, which acts as a type of natural genetic drive to allow Wolbachia to spread rapidly into uninfected mosquito populations [21]. Wolbachia infection can also cause pathogen blocking, which makes mosquitoes resistant to infection with key pathogens and decreases the likelihood that these pathogens will be transmitted [22–24]. In LB1 line, wAlbB was found to induce An. stephensi refractory to both the human malaria parasite Plasmodium falciparum and the rodent parasite P. berghei [20,25].

Strategies that utilize Wolbachia to control arbovirus transmission have shown considerable advancement, with successful field trials demonstrating population reductions [26,27] and reduced disease transmission through the replacement of pathogen-susceptible populations with Wolbachia-infected pathogen-resistant ones [21,28–30]. Similar efforts are underway in Hawaii, targeting Culex mosquitoes to control avian malaria [31]. However, the application of Wolbachia for malaria control is less developed, primarily because only one Wolbachia-transinfected Anopheles line was available until recently, and major resources were focused on developing Wolbachia for dengue control. Consequently, there is a need to develop additional transinfected lines, identify those with substantial parasite-blocking potential and minimal fitness costs, and assess the feasibility of a Wolbachia-based population suppression strategy to eradicate this invasive species and restore the original An. stephensi-free ecosystems in urban Africa.

In this study, we established the An. stephensi HP1 line transinfected with wPip, originally derived from Culex pipiens molestus. In the HP1 line, wPip exhibits perfect maternal transmission and induces nearly complete CI in crosses between infected males and uninfected wild females. While wPip in the HP1 line has little impact on mosquito fitness and shows tolerance to the rearing temperatures up to 38°C, it experiences a modest reduction in lifespan and female reproductive capacity, with wPip densities moderately decreasing when larvae are exposed to a constant 33°C and diurnal cyclic temperatures of 27–36°C and 27–38°C. These findings underscore the robustness of the HP1 line and its potential utility in vector control strategies.

Methods and materials

Ethics statement

This study was conducted in accordance with the recommendations of the Animal Care and Use Committee (ACUC) of Sun Yat-sen University. Mice were used for mosquito rearing according to protocol SYSU-IACUC-2022-B0023, approved by the Institutional Animal Care and Use Committee (IACUC) of Sun Yat-sen University.

Mosquito colonies

Originally collected from India, the An. stephensi Hor line was provided by Professor Wen-Yue Xu [32]. The Ae. albopictus transinfected GTM line was established by transferring Wolbachia wPip from Cx. pipiens molestus, a gift from Professor Tongyan Zhao, into a tetracycline-treated Ae. albopictus Guangzhou line through embryonic microinjection in our laboratory in 2014. Since then, wPip has stably maintained 100% maternal transmission in the GTM line. Both An. stephensi line and GTM line were maintained on 10% sugar solution at 27 ± 1°C, 70 ± 10% with a 12-hr L/D (light/dark) cycle [20]. Five to seven days old female mosquitoes were fed on the blood of anesthetized mice to initiate egg development.

Embryonic microinjection

Embryonic microinjection involved transferring cytoplasm from GTM embryos into the posterior of recipient Hor embryos, following previously reported procedures with minor modifications [20,33]. Post-injection, embryos were incubated at 70% relative humidity and 27°C for approximately 40 minutes, then removed from oil (Halocarbon oil 700, Simga) and placed on wet filter paper supported by water-soaked cotton. Hatched larvae were reared under standard maintenance conditions as described earlier. The establishment of an isofemale line and screening for stable transinfection followed methods previously detailed [20,33]. Briefly, G0 females were isolated as virgins and mated with Hor males. After oviposition, G0 parents were tested for Wolbachia infection using the universal primers 81F and 691R [34], based on established protocols [20,26]. G0 females testing negative for Wolbachia were discarded along with their progeny. This screening process was repeated in each generation until all offspring tested positive for Wolbachia infection. After nine generations of screening, we established the transinfected An. stephensi HP1 line with a stable Wolbachia infection, which has been outcrossed with Hor for six generations to homogenize the host genetic background before further study.

CI crosses

At G30, standard crosses were conducted to evaluate the patterns and intensity of cytoplasmic incompatibility (CI) [20]. Each cross involved three replicates, consisting of 10 virgin females and 10 virgin males. Adults had constant access to a 10% sucrose solution. Mating was allowed for five days before the females were blood-fed on anesthetized mice. Two days post-blood meal, oviposition cups lined with wet filter paper were placed in the cages. Females were given 2 to 3 days to lay eggs on the filter paper. Egg hatch rates were assessed two days post-hatching under a dissecting microscope.

PCR assay of Wolbachia densities in the whole bodies and different tissues of HP1 line

qPCR was conducted to assess Wolbachia densities in the whole bodies, ovaries, midguts, fat bodies, salivary glands of 7-day-old females and the whole bodies of 7-day-old males, with five replicates for each tissue or whole body. All the tissues were dissected in 1× PBS solution, and DNA from these tissues was extracted individually following previously described methods [20]. Wolbachia density for each sample was quantified using ChamQ SYBR qPCR Master Mix (Without ROX). The assay targeted the Wolbachia wsp gene and the host ribosomal protein S6 (rps6) gene using specific primers. The primers for rps6 gene were as previous described [20], and those for wPip wsp gene were: wPip F: TATTTCCCACTATATCCCTTC; wPip R: GGATTTGACCTTTCCGGC [26]. Two recombinant plasmids containing the targeted gene fragments were serially diluted to construct separate standard curves for the wsp and rps6 genes.

Immature development

For both HP1 line and Hor line, larval development and survival were determined as previously described [35]. Firstly, 150 larvae (< 2h old) were transferred to a plastic container (20 * 10 * 5 cm) filling with 1,000 ml distilled water. Bovine liver powder solution at a concentration of 60 g/L was provided daily. Three biological replicates were performed for each group. Pupae were collected daily at 9:00 am and 4:00 pm and transferred to culture tubes. Adult emergence was also recorded daily at 9:00 am, 12:00 am and 3:00 pm. Time to pupation and time to emergence were both recorded as the time required for the development of L1 to pupa and L1 to adult stages, respectively. Survival to pupation and survival to adult emergence were calculated as the proportion of larvae that survived from L1 to pupal stage and from L1 to adult stage, respectively.

Wing length

To assess adult size, the left wing of 29 males and 29 females from each line was collected for measurement under a microscope (Olympus CX31, Japan). The wing length was determined by measuring the distance from the distal edge of the alula to the end of the radius vein (excluding fringe scales) [35]. Three replicates of 29 males and 29 females each were conducted per line.

Adult longevity

Adult longevity was assessed as previously described with slight modifications [35]. Twenty-five newly emerged males and females each were placed in 15 × 15 × 15 cm stainless steel cages, with continuous access to a 10% sugar solution. Adult longevity was assessed under four different feeding regimes: (a) virgin males receiving only sugar solution, (b) virgin females receiving only sugar solution, (c) mated females receiving only sugar solution, and (d) mated females receiving both sugar solution and weekly blood meals that were repeated more than four times. Three biological replicates were conducted for each feeding regime. Mosquito mortality was monitored daily; dead individuals were counted and removed to determine longevity, continuing until all mosquitoes in each cage had perished.

Female fecundity and fertility

To assess female fecundity and fertility, 6- to 7-day-old females from the maintenance colonies were randomly selected and placed into a new 23 × 23 × 23 cm stainless steel cage [20,35]. After providing a blood meal, unfed mosquitoes were removed. Two days later, thirty-one individual females were transferred to 50-ml tubes lined with wet filter paper at the bottom for egg collection. After collecting eggs for two nights, the females were removed. The oviposition filter papers were transferred the next day to a hatching cup with fresh water and some larval food, and allowed to hatch over two days. Then the hatched eggs and the total number of eggs were scored under a microscope.

Male mating competitiveness assay

The mating competitiveness of HP1 and Hor males with Hor females was assessed with minor modifications from previous methods [35]. Before the experiment, males and females were placed separately in laboratory cages (23 × 23 × 23 cm). For the assay, males were released into large cages one hour before introducing the females. Twenty 1–2 day-old Hor females were paired with 2–3 day-old Hor and HP1 males in varying ratios: 1:0, 1:1, 1:3, 1:5, and 0:1, with three to five biological replicates conducted for each ratio. Mating was allowed for five days before the females were blood-fed on anesthetized mice. Two days post-blood meal, oviposition cups lined with wet filter paper were placed in the cages. The females were given 2 to 3 days to lay eggs on the filter paper. Egg hatch rates were assessed two days post-hatching under a microscope as described above, and compared against an expected rate based on the assumption of equal mating competitiveness between HP1 and Hor males under random mating conditions. The Fried male mating competitiveness index was calculated following established methods [36].

Temperature sensitivity studies under laboratory conditions

Two temperature regimens were used to evaluate the tolerance of HP1 line to high temperatures in term of their impacts on Wolbachia density and mosquito immature development. In the first regimen, first-instar larvae of HP1 line and Hor line were exposed to temperature maintained constantly at 30°C, 33°C, 36°C and 38°C up to pupal stage. In the second regimen, the larvae were reared at diurnal cyclic temperatures of 27–33°C, 27–33°C, 27–36°C and 27–38°C to pupae. Batches of 30 first-instar larvae of each strain were released separately into a plastic container (20 * 10 * 5 cm) filling with 300 mL distilled water and the containers were placed inside an artificial climate Chamber till the larvae pupated. The water baths were set to maintain temperature constantly at 30°C, 33°C, 36°C and 38°C or at daytime cycling temperatures of 27–33°C, 27–33°C, 27–36°C and 27–38°C. Three replicates (each with 30 larvae) were kept for each temperature regimen and for each strain. Simultaneously, larvae of HP1 line and Hor line were maintained constantly at 27 ± 1°C as controls for each experiment. The larvae were fed with Bovine liver powder solution as described above. The water temperature was recorded using submerging data loggers. Pupae were collected daily at 9:00 am and 3:00 pm and transferred to 15 ml culture tubes containing 1 ml of water. All tubes were kept at a temperature of 27°C. Adult emergence was also recorded daily at 9:00 am and 3:00 pm. Survival to pupation and survival to adult emergence were calculated as the proportion of larvae that survived from L1 to pupal stage and from L1 to adult stage, respectively. Five-day-old adults emerged from all the treatment were used to detect the Wolbachia frequency and density by qPCR as described above [20,26].

Statistical analysis

All data were analyzed using Graphpad Prism 9.0 or SPSS 26 software. Kolmogorov-Smirnov tests were used to analyze whether the data obeyed normal distribution. Student’s t test or Mann-Whitney U test was then used to analyze the significant difference in fecundity and fertility of female mosquitoes, Wolbachia density of females and males, survival assays and wing length. The life span of adult mosquitoes was analyzed using Log-rank (Mantel-Cox) tests, and the comparison between the experimental and predicted mating competitiveness of males was analyzed using one sample t test. ANOVA, followed by Tukey post-hoc tests, was used to analyze the significant difference in CI cross, Wolbachia density in female tissues, and temperature sensitivity of the HP1 line.

Results

Generation of the HP1 line

In order to establish novel Wolbachia transinfection in An. stephensi, we transferred Wolbachia from wPip-transinfected Ae. albopictus GTM line into An. stephensi wild-type Hor line by embryonic microinjection. There were 81 larvae hatched from 920 Hor embryos injected, resulting in 68 pupae and 59 adults (G0) survived (Table 1). Screening of those adults detected Wolbachia infections in 44.1% and 36.0% of males and females, respectively. Individual isofemale line was established from each of 9 infected G0 females by outcrosses with Hor males and only three of them produced G1 offsrpings. We observed only one isofemale line successfully inherited wPip into G1 progenies, achieving approximately 30% maternal transmission efficiency (Tables 1 and S1). Three positive G1 females were outcrossed with Hor males to establish the next generation and Wolbachia infections were detected in 71.4% and 60.0% of male and female G2 progenies, respectively (Table 1). The positive female offspring were individually crossed with Hor males to obtain their next generations and screen was repeated until 100% maternal transmission efficiency was observed at both G9 and G10 (S2 Table). This transinfected line, which was outcrossed with Hor for six generations (from G1 to G6), is hereafter referred to as the HP1 line. The stability of maternally inherited wPip infection in HP1 was confirmed by PCR assay of randomly selected individuals at the subsequent generations until G55 (the last generation assayed in this study thus far) (Figs 1 and S1 and S2 Tables). Thus, we succeeded in establishing the second Wolbachia transinfection in Anopheles, following the previous LB1 line transinfected with wAlbB.

Download:

Fig 1. Generation of a stable wPip transinfection in An. stephensi through intensive PCR-screenings over multiple generations.

In each generation, 8 to 16 female parents from each isofemale line were individually assayed by PCR to detect wPip infection after producing offspring. Offsprings from positive mothers were pooled to establish subsequent generations for further screening. Generation 0 consists of individuals that survived embryonic microinjection.

https://doi.org/10.1371/journal.pntd.0012523.g001

Download:

Table 1. Survival of microinjected An. stephensi embryos and the resulting Wolbachia wPip infection status in the G0, G1 and G2 adults.

https://doi.org/10.1371/journal.pntd.0012523.t001

CI crosses and Wolbachia densities across whole bodies and different tissues of HP1 mosquitoes

To determine whether wPip induces CI in An. stephensi, we set up the crosses between transinfected HP1 and wild-type Hor lines. Out of 1,992 eggs resulting from crosses between HP1 males and Hor females, nearly no egg hatched (0.8 ± 0.1%), whereas HP1 females rescued CI when mating with HP1 males, with the egg hatch rates (62.9 ± 5.2%), slightly lower than both the self-crosses of Hor (79.6 ± 1.7%) and compatible crosses between HP1 females and Hor males (75.5 ± 3.1%) (Fig 2A and S3 Table, ANOVA analysis, F_{3, 8} = 133.3, P < 0.05). These results are similar to the previous observation in wAlbB-infected LB1 line, indicating a typical pattern of unidirectional CI induced by wPip in An. stephensi. In contrast to the normal embryonic development with dark black pigment, CI embryos stayed at light color, indicating deficiency in eggshell melanization (Fig 2B and 2C).

Download:

Fig 2. CI crosses and Wolbachia densities in the whole bodies and different tissues of HP1 mosquitoes.

(A) Results of reciprocal crosses between the HP1 line and wild non-infected Hor line. (B) An. stephensi embryos in the compatible crosses with normal development. (C) An. stephensi embryos in the CI crosses with the early death during development. (D) Relative densities of wPip in HP1 females or males at 7 days old. (E) Relative density of wPip in ovaries, midguts, fat bodies, salivary glands of 7-day-old non-blood-fed HP1 females. wsp and rps6 genes were used as target and host reference genes, respectively. Error bars represent the standard errors based on 3 biological replicates for A and 5 biological replicates for D and E. Different lowercase letters above each column indicate significant differences, P < 0.05, Student’s t test for D, ANOVA analysis, followed by Tukey post-hoc tests for A and E.

https://doi.org/10.1371/journal.pntd.0012523.g002

To examine the densities of wPip across different tissues in HP1, we collected the whole bodies of both sexes as well as the midguts, salivary glands, ovaries and fat bodies of 7-day-old non-blood-feeding females, and measured the numbers of wPip genome copies using real-time qPCR. The results showed that wPip densities in the whole bodies of females were significantly higher than in the males (Fig 2D, Student’s t test, P < 0.05). Furthermore, the fat bodies exhibited the highest wPip densities among all the tissues, followed by ovaries and salivary glands, with the lowest wPip densities in midguts (Fig 2E, ANOVA analysis, F_{3, 16} = 62.34, P < 0.05). These results indicate that wPip has distinct tissue tropism, being highly enriched in fat bodies but only minimally present in midguts.

Impact of wPip on the development and body size of HP1 line

To examine the impact of wPip on the development and body size of An. stephensi, we assessed life history traits and adult body sizes of HP1 and Hor lines. There were no significant differences in survivorship and development time from the L1 larval stage to pupae/adults, sex ratios, or wing lengths of both females and males between the HP1 and Hor lines (Table 2). These results indicate that, similar to observations in the LB1 line, there are no measurable fitness costs associated with immature development and adult body size in An. stephensi due to wPip.

Download:

Table 2. Life history traits and adult body sizes of HP1 and Hor lines.

https://doi.org/10.1371/journal.pntd.0012523.t002

Impact of wPip on the longevity of HP1 line

In order to determine whether wPip impacts the lifespan of HP1 mosquitoes, we compared the longevity of HP1 mosquitoes and Hor mosquitoes under different rearing conditions. When unmated mosquitoes were provided with sugar solution only, both males (Fig 3A, Log-rank test, χ² = 4.28, df = 1, P = 0.0385) and females (Fig 3B, Log-rank test, χ² = 4.88, df = 1, P = 0.0272) of HP1 line showed a significantly decreased lifespan as compared to the counterparts of Hor line. The median lifespan was 21 days for HP1 males and 26 days for Hor males, while it was 36 days for HP1 females and 40 days for Hor females. Interestingly, HP1 females appeared to survive better during the first 30 days; however, this trend reversed subsequently, with Hor females demonstrating superior survival thereafter (Fig 3B). We then measured the lifespan of mated females by providing with sugar solution only and observed that the HP1 females had the median lifespan 30 days, significantly lower than Hor females, with the median lifespan 47 days (Fig 3C, Log-rank test, χ2 = 50.87, df = 1, P < 0.0001). We further assessed the lifespan of the mated females by providing with both bloodmeal and sugar solution. Again, the HP1 females had the median lifespan 18 days after the first blood meal, significantly lower than Hor females, with the median lifespan 21 days (Fig 3D, Log-rank test, χ2 = 6.77, df = 1, P = 0.0093). Taken together, wPip decreases the lifespan of An. stephensi in all the three rearing conditions.

Download:

Fig 3. The impacts of wPip on the longevity of HP1 line.

(A) The survival curves of unmated males, provided with sugar water only. (B) The survival curves of unmated females, provided with sugar only. (C) The survival curves of mated females, provided with sugar only. (D) The survival curves of mated females, privided with both sugar and blood meal. The dead mosquitoes were removed with an aspirator and recorded daily after the first blood meal. The curves represent the mean percentage of mosquitoes surviving from three biological replicates each day. Log-rank test was used to analyze significant differences in the longevity of adult mosquitoes between HP1 line and Hor line. P < 0.05 for A to D.

https://doi.org/10.1371/journal.pntd.0012523.g003

Impact of wPip on the reproduction of HP1 line

To investigate whether wPip influences the reproduction of HP1 line, we compared the fecundity (the number of eggs laid by a female) and fertility (egg hatch rate) of females between HP1 and Hor lines. The results show HP1 females produced a significantly lower number of eggs (89.2 ± 3.3) than Hor females (107.4 ± 3.1) (Fig 4A, Student’s t test, P < 0.05), and the hatch rates of eggs produced by HP1 females (62.0 ± 1.9%) also were significantly lower than Hor females (89.2 ± 1.4%) (Fig 4B, Student’s t test, P < 0.05), likely due to partial self-incompatibility.

Download:

Fig 4. The impact of wPip on the reproduction of HP1 line.

(A) The fecundity of HP1 line and Hor line. (B) The eggs hatch rates of HP1 line and Hor line. (C) Egg hatch rates in laboratory cage populations with different Hor female: HP1 male: Hor male ratios. The red line illustrates the observed egg hatching rates, while the black line illustrates the expected egg hatching rates, assuming equal mating competitiveness of HP1 and Hor males and random mating. (D) HP1 male mating competitiveness index. Error bars represent the standard errors based on the biological replicates (n = 31 for A and B, n = 3 to 5 for C, and n = 5 for D). Different lowercase letters above each column indicate significant differences in values, P < 0.05, Student’s t test for A and B, One sample t test for C and D.

https://doi.org/10.1371/journal.pntd.0012523.g004

We then examined the impact of wPip on the competitiveness of HP1 males to mate with Hor females relative to Hor males. Five (1:1) or three cages (0:1, 3:1, 5:1, and 1:0) containing Hor females and different ratios of HP1 males to Hor males were set up. We found that the egg hatch rate was decreased as the ratio of HP1 males increased in the cages (Fig 4C). Consistent with the CI induction, near no egg hatched (0.59 ± 0.17%) at the ratio 1:0, where only HP1 males mated with Hor females. There were no significant differences between the observed egg hatch rates and the predicted values assuming equal competitiveness of HP1 and Hor males and random mating (Fig 4C, One sample t test, P > 0.05). The male mating competitiveness index at the 1:1 ratio of HP1 males to Hor males was 1.148 ± 0.34, not significantly different from 1 (Fig 4D, one sample t test, P = 0.4393).

Tolerance of HP1 mosquito to high temperatures

To investigate the tolerance of wPip-Anopheles symbiosis to high temperature, HP1 and Hor larvae were exposed to constant temperatures of 30°C, 33°C, and 27°C (control) and diurnal cyclic temperatures of 27–30°C, 27–33°C, 27–36°C, or 27–38°C. The results showed Wolbachia infection frequency maintained 100% in HP1 females and males under all of constant and cyclic temperatures. The Wolbachia density in HP1 males exposed to the constant temperatures of 30°C as larvae did not differ significantly from the control 27°C; however, the Wolbachia densities in HP1 males exposed to 33°C as larvae were significantly lower than in those exposed to 30°C and 27°C as larvae (Fig 5A, ANOVA analysis, F_{2, 21} = 5.875, P < 0.05). At the diurnal cyclic temperatures, there was no significant difference in Wolbachia densities among HP1 males exposed to 27°C, 27–30°C, 27–33°C as larvae; however, while HP1 males exposed to temperatures of 27–36°C and 27–38°C as larvae exhibited similar Wolbachia densities, these densities were significantly lower compared to other groups (Fig 5A, ANOVA analysis, F_{4, 35} = 7.320, P < 0.05). Furthermore, HP1 females exposed to 30°C and 33°C as larvae exhibited significantly lower Wolbachia densities than that exposed to 27°C as larvae (Fig 5B, ANOVA analysis, F_{2, 21} = 8.515, P < 0.05). Under the diurnal cyclic temperatures, HP1 females exposed to 27–36°C and 27–38°C as larvae also had significantly lower Wolbachia densities than those exposed to 27–30°C, 27–33°C and 27°C as larvae; by contrast, HP1 female exposed to 27–30°C as larvae had the highest Wolbachia densities among all the tested groups (Fig 5B, ANOVA analysis, F_{4, 35} = 33.08, P < 0.05). No difference in Wolbachia densities was observed between 30°C and 33°C, between 27–36°C and 27–38°C, and between 27°C and 27–33°C (Fig 5B). These results suggest that wPip densities in An. stephensi may decrease as environmental temperatures reach sufficiently high levels. However, this transinfection remains robust to a certain extent, maintaining a 100% infection frequency even under elevated temperatures.

Download:

Fig 5. The tolerance of HP1 line to high temperatures.

Wolbachia densities of male (A) and female (B) in HP1 adults after larvae exposure to either constant temperatures or different diurnal cyclic temperatures. The constant temperature of 27 ± 1°C is used as the control group. wsp and rps6 genes are used as target gene and host reference gene, respectively. Error bars represent the standard errors based on eight biological replicates. Different lowercase letters above each column indicate significant differences in values, P < 0.05 (ANOVA analysis, followed by Tukey post-hoc tests).

https://doi.org/10.1371/journal.pntd.0012523.g005

In addition to Wolbachia densities, we also examined whether high larvae rearing temperature stress might differ in their impacts on the development of HP1 and Hor lines. We found that both HP1 and Hor lines exhibited a decrease in pupae and adult emergence rates with the increase of larvae rearing temperature to 33°C, 36°C, 38°C, 27–36°C, and 27–38°C compared to 27°C and other treatments (S2 Fig). However, under the same rearing temperatures, even at high larvae rearing temperatures, there were no differences in the pupation rates and adult emergence rates between HP1 and Hor lines (S2 Fig).

Discussion

In this study, we have succeeded in transferring Wolbachia wPip into An. stephensi and established a stable maternally inherited artificial infection, which is the second Wolbachia transinfection in Anopheles mosquitoes. We show that wPip in An. stephensi induces nearly complete unidirectional CI and distributes in both somatic and germline tissues. There is no impact of wPip on immature survivorship and development time, sex ratio, body size and male mating competitiveness. By contrast, wPip reduces both the life span of transinfected mosquito and female reproduction capacity. While exposing larvae to high temperature reduces the densities of wPip and negatively affects immature development, Wolbachia infection frequence has been stably maintained at 100% in the transinfected line and there is no difference in immature tolerance to high temperature between transinfected and wild-type lines. These results support the robustness of the wPip transinfection in Anopheles with only moderate fitness cost detected and highlight its potential to be used for malaria control in endemic countries.

The generation of the 2nd transinfection in An. stephensi allows us to analyze the phenotypes induced by these two supergroup B strains, wPip and wAlbB. However, direct comparison should be avoided as they were studied in separate experiments. Both strains induce near complete CI, with egg hatch rates in the CI crosses 0.8% and 1.2% for wPip and wAlbB [20], respectively. The self-crosses of both transinfected lines show reduced egg hatch compared to the other two compatible crosses, which might be caused by partial self-incompatibility or a transinfection-associated cost on female reproduction rather than inbreeding effects. This is evidenced by the persistence of reduced hatching after outcrossing with wild types for six generations and by normal egg hatch rates observed in crosses between transinfected females and wild-type males. Similar to wAlbB, wPip has the highest density in fat bodies and lowest in midguts among the tested tissues, different with their native infection, typically highly enriched in ovaries related to somatic tissues [37]. Both wPip and wAlbB have no impact on the life history traits and sex ratio of the transinfected lines, with either no or very minor impact on male mating competitiveness [35]. While wAlbB increased the longevity of An. stephensi when mosquitoes were provided with sugar alone [35], wPip consistently reduced mosquito life span when providing with either sugar alone or blood meal. In general, although the two transinfected lines were generated from different host backgrounds in either the LIS or Hor strain [20,32], they exhibit more similarities than differences, indicating the presence of conserved interactions between Wolbachia supergroup B and Anopheles hosts. Given that wAlbB induces resistance to both P. berghei [25] and P. falciparum [20], while wPip does not inhibit dengue viruses in transinfected Aedes aegypti [38], it would be informative to investigate the impact of wPip on vector competence for malaria parasites. Furthermore, a previous report shows no relationship between Wolbachia density and the blocking of parasites [39], calling for further investigation into the Anopheles-Wolbachia-Plasmodium interactions.

Although not evaluated in wAlbB-infected An. stephensi, we investigated the tolerance of the wPip-transinfected HP1 line to heat stress during the immature stage, given Anopheles larvae can still be found alive when the water temperature at the breeding habitat reaches 36°C [40] in malaria endemic areas, and the temperature sensitivity of Wolbachia-mosquito associations observed in the transinfected Aedes mosquitoes [41–43]. Importantly, none of the high larvae rearing temperature treatments resulted in loss of Wolbachia in transinfected line. For both males and females, we observed a consistent reduction in wPip densities when larvae were exposed to sufficiently high temperatures, including a constant temperature of 33°C, as well as to diurnal cyclic temperatures of 27–36°C and 27–38°C. However, upon exposure to 30°C, wPip densities decreased in females but remained unchanged in males. Additionally, cyclic temperatures of 27–30°C did not affect wPip densities in males, yet increased them in females. These findings suggest a gender-specific difference in regulation of wPip densities by temperature.

Heat stress is reported to have negative, strain-specific effects on CI and Wolbachia load [41–43]. Increased temperatures are associated with a reduced expression of CI and lowered Wolbachia density, and this trend appears to vary by strain in the transinfected Ae. aegypti (e.g., more marked in wMel than in wAlbB) [43]. As a nutrition-consuming parasite, Wolbachia increases the mosquito’s energy requirements, and there is likely a trade-off between this increased energy requirement and mosquito fitness at increasing temperatures [44]. Although field trials have demonstrated that the wMel strain can achieve Ae. aegypti population replacement and dengue control in some regions, such as Australia and Indonesia [21,30], this same Wolbachia strain struggles to spread in other areas, such as Vietnam and Brazil [45,46], pointing to temperature and other environmental conditions as the key drivers for the low efficacy in certain settings. Field populations experience variable temperatures and periods of rainfall, as well as limited food resources available to larvae, likely leading some Wolbachia strains to parasitize mosquitoes by depleting their energetic resources and reducing their fitness, as observed in wMelPop- and wAlbB- transinfected Ae. aegypti [47]. In addition, both wAlbB and wMel are reported to reduce the thermal tolerance of Ae. aegypti [43,48]. However, we have not observed increased sensitivity to high temperatures in the immature development and survivorship of the HP1 line relative to its wild counterpart. An. stephensi is reported to survive extremely high temperatures during the dry season, when malaria transmission usually reaches a seasonal low. Thus, future studies are needed to assess how these stressful field conditions will affect Wolbachia densities and CI expression, and compare how known environmental factors affect Wolbachia-Anopheles-Plasmodium interactions across different Wolbachia strains.

The expansion of An. stephensi has triggered a recent WHO initiative aimed at determining whether this vector can be eradicated from regions it has already established. The successful application of the Incompatible Insect Technique (IIT) for eliminating the invasive mosquito species Aedes albopictus [26], combined with the lack of negative impact of wPip on the mating competitiveness of HP1 males observed in this study, supports the potential of releasing incompatible males to suppress and eliminate An. stephensi populations. However, it is more challenging to achieve mass production and sex separation in Anopheles mosquitoes compared to Aedes mosquitoes. We noted a wPip-associated fitness cost affecting female reproduction and adult lifespan. Such reductions in female fecundity and fertility may increase the cost of mass-rearing the transinfected line. In strategies involving population replacement, these fitness costs could increase the threshold frequency of Wolbachia required for successful replacement. However, once replacement is achieved, these costs could potentially facilitate disease control by both lowering mosquito density and reducing the probability of mosquitoes surviving through the extrinsic incubation period. The variability of these fitness costs with environmental conditions and mosquito genetic backgrounds, and their potential impacts on the spread of wPip in field populations, remain to be explored.

In conclusion, we have successfully established wPip transinfection in An. stephensi. The ability of wPip to achieve perfect maternal transmission, induce nearly complete CI, and exhibit no measurable fitness cost on the immature development and male mating competitiveness in the HP1 line while maintaining reduced infection densities at temperatures up to 38°C supports further evaluation of the HP1 line for malaria control. Future studies should investigate the wPip-mediated Plasmodium blocking effect, its potential to induce population replacement and suppression, and the long-term stability of Wolbachia-Anopheles associations under real-world field conditions.

Supporting information

S1 Table. PCR-screening of wPip infection in the G1 offsprings developed from the nine wPip-positive G0 isofemale lines.

https://doi.org/10.1371/journal.pntd.0012523.s001

(DOCX)

S2 Table. wPip positive rates in the PCR-screening of HP1 line from G1 to G10.

https://doi.org/10.1371/journal.pntd.0012523.s002

(DOCX)

S3 Table. Cytoplasmic incompatibility (CI) between the HP1 line and Hor line.

https://doi.org/10.1371/journal.pntd.0012523.s003

(DOCX)

S1 Fig. Representative PCR results for validation of the perfect wPip maternal transmission in HP1 line at different generations.

https://doi.org/10.1371/journal.pntd.0012523.s004

(TIF)

S2 Fig. The impact of high temperatures on the immature development of HP1 line and Hor line.

https://doi.org/10.1371/journal.pntd.0012523.s005

(TIF)

S1 Data. Excel spreadsheet containing, in separate sheets, the underlying numerical data and statistical analysis for Table 2 and Figs 1, 2A, 2D, 2E, 3A–3D, 4A–4D, 5A, 5B, S2A and S2B of the study.

https://doi.org/10.1371/journal.pntd.0012523.s006

(XLSX)

Acknowledgments

We would like to thank Professor Wen-Yue Xu for providing the Hor line for this work, and Professors Zhongdao Wu, Xiaoying Zheng and Dongjing Zhang for their technical assistance.

References

1. Cowman AF, Healer J, Marapana D, Marsh K. Malaria: Biology and Disease. Cell. 2016;167(3):610–24. pmid:27768886.
- View Article
- PubMed/NCBI
- Google Scholar
2. Hay SI, Guerra CA, Tatem AJ, Noor AM, Snow RW. The global distribution and population at risk of malaria: past, present, and future. Lancet Infect Dis. 2004;4(6):327–36. pmid:15172341; PubMed Central PMCID: PMC3145123.
- View Article
- PubMed/NCBI
- Google Scholar
3. WHO. World malaria report 2023. Geneva: World Health Organization; 2023.
4. Uhlemann AC, Fidock DA. Loss of malarial susceptibility to artemisinin in Thailand. Lancet. 2012;379(9830):1928–30. Epub 20120405. pmid:22484133.
- View Article
- PubMed/NCBI
- Google Scholar
5. Phyo AP, Nkhoma S, Stepniewska K, Ashley EA, Nair S, McGready R, et al. Emergence of artemisinin-resistant malaria on the western border of Thailand: a longitudinal study. Lancet. 2012;379(9830):1960–6. Epub 20120405. pmid:22484134; PubMed Central PMCID: PMC3525980.
- View Article
- PubMed/NCBI
- Google Scholar
6. Uwimana A, Legrand E, Stokes BH, Ndikumana JM, Warsame M, Umulisa N, et al. Emergence and clonal expansion of in vitro artemisinin-resistant Plasmodium falciparum kelch13 R561H mutant parasites in Rwanda. Nat Med. 2020;26(10):1602–8. Epub 20200803. pmid:32747827; PubMed Central PMCID: PMC7541349.
- View Article
- PubMed/NCBI
- Google Scholar
7. Surendran SN, Sivabalakrishnan K, Sivasingham A, Jayadas TTP, Karvannan K, Santhirasegaram S, et al. Anthropogenic Factors Driving Recent Range Expansion of the Malaria Vector Anopheles stephensi. Front Public Health. 2019;7:53. Epub 20190314. pmid:30923705; PubMed Central PMCID: PMC6426791.
- View Article
- PubMed/NCBI
- Google Scholar
8. Sinka ME, Bangs MJ, Manguin S, Chareonviriyaphap T, Patil AP, Temperley WH, et al. The dominant Anopheles vectors of human malaria in the Asia-Pacific region: occurrence data, distribution maps and bionomic précis. Parasit Vectors. 2011;4:89. Epub 20110525. pmid:21612587; PubMed Central PMCID: PMC3127851.
- View Article
- PubMed/NCBI
- Google Scholar
9. WHO. WHO initiative to stop the spread of Anopheles stephensi in Africa, 2023 update. Available from: https://www.who.int/publications/i/item/WHO-UCN-GMP-2022.06.
- View Article
- Google Scholar
10. Yared S, Gebressielasie A, Damodaran L, Bonnell V, Lopez K, Janies D, et al. Insecticide resistance in Anopheles stephensi in Somali Region, eastern Ethiopia. Malar J. 2020;19(1):180. Epub 20200512. pmid:32398055; PubMed Central PMCID: PMC7216317.
- View Article
- PubMed/NCBI
- Google Scholar
11. Syafrudin M, Kristanti RA, Yuniarto A, Hadibarata T, Rhee J, Al-Onazi WA, et al. Pesticides in Drinking Water-A Review. Int J Environ Res Public Health. 2021;18(2). Epub 20210108. pmid:33430077; PubMed Central PMCID: PMC7826868.
- View Article
- PubMed/NCBI
- Google Scholar
12. Zug R, Hammerstein P. Still a host of hosts for Wolbachia: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One. 2012;7(6):e38544. Epub 20120607. pmid:22685581; PubMed Central PMCID: PMC3369835.
- View Article
- PubMed/NCBI
- Google Scholar
13. Shaw WR, Marcenac P, Childs LM, Buckee CO, Baldini F, Sawadogo SP, et al. Wolbachia infections in natural Anopheles populations affect egg laying and negatively correlate with Plasmodium development. Nat Commun. 2016;7:11772. Epub 20160531. pmid:27243367; PubMed Central PMCID: PMC4895022.
- View Article
- PubMed/NCBI
- Google Scholar
14. Gomes FM, Hixson BL, Tyner MDW, Ramirez JL, Canepa GE, Alves ESTL, et al. Effect of naturally occurring Wolbachia in Anopheles gambiae s.l. mosquitoes from Mali on Plasmodium falciparum malaria transmission. Proc Natl Acad Sci U S A. 2017;114(47):12566–71. Epub 20171107. pmid:29114059; PubMed Central PMCID: PMC5703331.
- View Article
- PubMed/NCBI
- Google Scholar
15. Baldini F, Rougé J, Kreppel K, Mkandawile G, Mapua SA, Sikulu-Lord M, et al. First report of natural Wolbachia infection in the malaria mosquito Anopheles arabiensis in Tanzania. Parasit Vectors. 2018;11(1):635. Epub 20181213. pmid:30545384; PubMed Central PMCID: PMC6293665.
- View Article
- PubMed/NCBI
- Google Scholar
16. Jeffries CL, Lawrence GG, Golovko G, Kristan M, Orsborne J, Spence K, et al. Novel Wolbachia strains in Anopheles malaria vectors from Sub-Saharan Africa. Wellcome Open Res. 2018;3:113. Epub 20181127. pmid:30483601; PubMed Central PMCID: PMC6234743.
- View Article
- PubMed/NCBI
- Google Scholar
17. Niang EHA, Bassene H, Makoundou P, Fenollar F, Weill M, Mediannikov O. First report of natural Wolbachia infection in wild Anopheles funestus population in Senegal. Malar J. 2018;17(1):408. Epub 20181106. pmid:30400987; PubMed Central PMCID: PMC6219158.
- View Article
- PubMed/NCBI
- Google Scholar
18. Walker T, Quek S, Jeffries CL, Bandibabone J, Dhokiya V, Bamou R, et al. Stable high-density and maternally inherited Wolbachia infections in Anopheles moucheti and Anopheles demeilloni mosquitoes. Curr Biol. 2021;31(11):2310–20 e5. Epub 20210414. pmid:33857432; PubMed Central PMCID: PMC8210651.
- View Article
- PubMed/NCBI
- Google Scholar
19. Chrostek E, Gerth M. Is Anopheles gambiae a Natural Host of Wolbachia? mBio. 2019;10(3). Epub 20190611. pmid:31186318; PubMed Central PMCID: PMC6561020.
- View Article
- PubMed/NCBI
- Google Scholar
20. Bian G, Joshi D, Dong Y, Lu P, Zhou G, Pan X, et al. Wolbachia invades Anopheles stephensi populations and induces refractoriness to Plasmodium infection. Science. 2013;340(6133):748–51. pmid:23661760.
- View Article
- PubMed/NCBI
- Google Scholar
21. Hoffmann AA, Montgomery BL, Popovici J, Iturbe-Ormaetxe I, Johnson PH, Muzzi F, et al. Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature. 2011;476(7361):454–7. Epub 20110824. pmid:21866160.
- View Article
- PubMed/NCBI
- Google Scholar
22. Kambris Z, Cook PE, Phuc HK, Sinkins SP. Immune activation by life-shortening Wolbachia and reduced filarial competence in mosquitoes. Science. 2009;326(5949):134–6. pmid:19797660; PubMed Central PMCID: PMC2867033.
- View Article
- PubMed/NCBI
- Google Scholar
23. Moreira LA, Iturbe-Ormaetxe I, Jeffery JA, Lu G, Pyke AT, Hedges LM, et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell. 2009;139(7):1268–78. pmid:20064373.
- View Article
- PubMed/NCBI
- Google Scholar
24. Bian G, Xu Y, Lu P, Xie Y, Xi Z. The Endosymbiotic Bacterium Wolbachia Induces Resistance to Dengue Virus in Aedes aegypti. PLoS Pathogens. 2010;6(4). pmid:20368968
- View Article
- PubMed/NCBI
- Google Scholar
25. Joshi D, Pan X, McFadden MJ, Bevins D, Liang X, Lu P, et al. The Maternally Inheritable Wolbachia wAlbB Induces Refractoriness to Plasmodium berghei in Anopheles stephensi. Front Microbiol. 2017;8:366. Epub 20170308. pmid:28337184; PubMed Central PMCID: PMC5340780.
- View Article
- PubMed/NCBI
- Google Scholar
26. Zheng X, Zhang D, Li Y, Yang C, Wu Y, Liang X, et al. Incompatible and sterile insect techniques combined eliminate mosquitoes. Nature. 2019;572(7767):56–61. Epub 20190717. pmid:31316207.
- View Article
- PubMed/NCBI
- Google Scholar
27. Crawford JE, Clarke DW, Criswell V, Desnoyer M, Cornel D, Deegan B, et al. Efficient production of male Wolbachia-infected Aedes aegypti mosquitoes enables large-scale suppression of wild populations. Nat Biotechnol. 2020;38(4):482–92. Epub 20200406. pmid:32265562.
- View Article
- PubMed/NCBI
- Google Scholar
28. Nazni WA, Hoffmann AA, NoorAfizah A, Cheong YL, Mancini MV, Golding N, et al. Establishment of Wolbachia Strain wAlbB in Malaysian Populations of Aedes aegypti for Dengue Control. Curr Biol. 2019;29(24):4241–8 e5. Epub 20191121. pmid:31761702; PubMed Central PMCID: PMC6926472.
- View Article
- PubMed/NCBI
- Google Scholar
29. Ryan PA, Turley AP, Wilson G, Hurst TP, Retzki K, Brown-Kenyon J, et al. Establishment of wMel Wolbachia in Aedes aegypti mosquitoes and reduction of local dengue transmission in Cairns and surrounding locations in northern Queensland, Australia. Gates Open Research. 2020;3:1547. Epub 20200408. pmid:31667465; PubMed Central PMCID: PMC6801363.
- View Article
- PubMed/NCBI
- Google Scholar
30. Utarini A, Indriani C, Ahmad RA, Tantowijoyo W, Arguni E, Ansari MR, et al. Efficacy of Wolbachia-Infected Mosquito Deployments for the Control of Dengue. N Engl J Med. 2021;384(23):2177–86. pmid:34107180; PubMed Central PMCID: PMC8103655.
- View Article
- PubMed/NCBI
- Google Scholar
31. Vorsino AE, Xi Z. A mass rearing cost calculator for the control of Culex quinquefasciatus in Hawai’i using the incompatible insect technique. Parasit Vectors. 2022;15(1):453. Epub 20221205. pmid:36471389; PubMed Central PMCID: PMC9724328.
- View Article
- PubMed/NCBI
- Google Scholar
32. Zhang J, Zhang S, Wang Y, Xu W, Zhang J, Jiang H, et al. Modulation of Anopheles stephensi gene expression by nitroquine, an antimalarial drug against Plasmodium yoelii infection in the mosquito. PLoS One. 2014;9(2):e89473. Epub 20140224. pmid:24586804; PubMed Central PMCID: PMC3933544.
- View Article
- PubMed/NCBI
- Google Scholar
33. Xi Z, Khoo CC, Dobson SL. Wolbachia establishment and invasion in an Aedes aegypti laboratory population. Science. 2005;310(5746):326–8. pmid:16224027.
- View Article
- PubMed/NCBI
- Google Scholar
34. Zhou W, Rousset F, O’Neil S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc Biol Sci. 1998;265(1395):509–15. pmid:9569669
- View Article
- PubMed/NCBI
- Google Scholar
35. Joshi D, McFadden MJ, Bevins D, Zhang F, Xi Z. Wolbachia strain wAlbB confers both fitness costs and benefit on Anopheles stephensi. Parasit Vectors. 2014;7:336. Epub 20140721. pmid:25041943; PubMed Central PMCID: PMC4223616.
- View Article
- PubMed/NCBI
- Google Scholar
36. Fried M. Determination of Sterile-Insect Competitiveness. Journal of Economic Entomology. 1971;64:869–72.
- View Article
- Google Scholar
37. Lu P, Bian G, Pan X, Xi Z. Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells. PLoS Negl Trop Dis. 2012;6(7):e1754. Epub 20120724. pmid:22848774; PubMed Central PMCID: PMC3404113.
- View Article
- PubMed/NCBI
- Google Scholar
38. Fraser JE, O’Donnell TB, Duyvestyn JM, O’Neill SL, Simmons CP, Flores HA. Novel phenotype of Wolbachia strain wPip in Aedes aegypti challenges assumptions on mechanisms of Wolbachia-mediated dengue virus inhibition. PLoS Pathog. 2020;16(7):e1008410. Epub 20200729. pmid:32726353; PubMed Central PMCID: PMC7416964.
- View Article
- PubMed/NCBI
- Google Scholar
39. Hughes GL, Vega-Rodriguez J, Xue P, Rasgon JL. Wolbachia strain wAlbB enhances infection by the rodent malaria parasite Plasmodium berghei in Anopheles gambiae mosquitoes. Appl Environ Microbiol. 2012;78(5):1491–5. Epub 20111230. pmid:22210220; PubMed Central PMCID: PMC3294472.
- View Article
- PubMed/NCBI
- Google Scholar
40. Kripa PK, Thanzeen PS, Jaganathasamy N, Ravishankaran S, Anvikar AR, Eapen A. Impact of climate change on temperature variations and extrinsic incubation period of malaria parasites in Chennai, India: implications for its disease transmission potential. Parasit Vectors. 2024;17(1):134. Epub 20240315. pmid:38491547; PubMed Central PMCID: PMC11334410.
- View Article
- PubMed/NCBI
- Google Scholar
41. Ross PA, Wiwatanaratanabutr I, Axford JK, White VL, Endersby-Harshman NM, Hoffmann AA. Wolbachia Infections in Aedes aegypti Differ Markedly in Their Response to Cyclical Heat Stress. PLoS Pathog. 2017;13(1):e1006006. Epub 20170105. pmid:28056065; PubMed Central PMCID: PMC5215852.
- View Article
- PubMed/NCBI
- Google Scholar
42. Ross PA, Hoffmann AA. Continued Susceptibility of the wMel Wolbachia Infection in Aedes aegypti to Heat Stress Following Field Deployment and Selection. Insects. 2018;9(3). Epub 20180630. pmid:29966368; PubMed Central PMCID: PMC6165456.
- View Article
- PubMed/NCBI
- Google Scholar
43. Ross PA, Ritchie SA, Axford JK, Hoffmann AA. Loss of cytoplasmic incompatibility in Wolbachia-infected Aedes aegypti under field conditions. PLoS Negl Trop Dis. 2019;13(4):e0007357. Epub 20190419. pmid:31002720; PubMed Central PMCID: PMC6493766.
- View Article
- PubMed/NCBI
- Google Scholar
44. Mouton L, Henri H, Fleury F. Interactions between coexisting intracellular genomes: mitochondrial density and Wolbachia infection. Appl Environ Microbiol. 2009;75(7):1916–21. Epub 20090130. pmid:19181828; PubMed Central PMCID: PMC2663226.
- View Article
- PubMed/NCBI
- Google Scholar
45. Hien NT, Anh DD, Le NH, Yen NT, Phong TV, Nam VS, et al. Environmental factors influence the local establishment of Wolbachia in Aedes aegypti mosquitoes in two small communities in central Vietnam. Gates Open Res. 2021;5:147. Epub 20220407. pmid:35602266; PubMed Central PMCID: PMC9098883.
- View Article
- PubMed/NCBI
- Google Scholar
46. Pinto SB, Riback TIS, Sylvestre G, Costa G, Peixoto J, Dias FBS, et al. Effectiveness of Wolbachia-infected mosquito deployments in reducing the incidence of dengue and other Aedes-borne diseases in Niterói, Brazil: A quasi-experimental study. PLoS Negl Trop Dis. 2021;15(7):e0009556. Epub 20210712. pmid:34252106; PubMed Central PMCID: PMC8297942.
- View Article
- PubMed/NCBI
- Google Scholar
47. Ross PA, Endersby NM, Hoffmann AA. Costs of Three Wolbachia Infections on the Survival of Aedes aegypti Larvae under Starvation Conditions. PLoS Negl Trop Dis. 2016;10(1):e0004320. Epub 20160108. pmid:26745630; PubMed Central PMCID: PMC4706305.
- View Article
- PubMed/NCBI
- Google Scholar
48. Ware-Gilmore F, Sgrò CM, Xi Z, Dutra HLC, Jones MJ, Shea K, et al. Microbes increase thermal sensitivity in the mosquito Aedes aegypti, with the potential to change disease distributions. PLoS Negl Trop Dis. 2021;15(7):e0009548. Epub 20210722. pmid:34292940; PubMed Central PMCID: PMC8297775.
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Cowman AF, Healer J, Marapana D, Marsh K. Malaria: Biology and Disease. Cell. 2016;167(3):610–24. pmid:27768886.
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Hay SI, Guerra CA, Tatem AJ, Noor AM, Snow RW. The global distribution and population at risk of malaria: past, present, and future. Lancet Infect Dis. 2004;4(6):327–36. pmid:15172341; PubMed Central PMCID: PMC3145123.
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. WHO. World malaria report 2023. Geneva: World Health Organization; 2023.

[ref4] 4. Uhlemann AC, Fidock DA. Loss of malarial susceptibility to artemisinin in Thailand. Lancet. 2012;379(9830):1928–30. Epub 20120405. pmid:22484133.
View Article
PubMed/NCBI
Google Scholar

[11] View Article

[12] PubMed/NCBI

[13] Google Scholar

[ref5] 5. Phyo AP, Nkhoma S, Stepniewska K, Ashley EA, Nair S, McGready R, et al. Emergence of artemisinin-resistant malaria on the western border of Thailand: a longitudinal study. Lancet. 2012;379(9830):1960–6. Epub 20120405. pmid:22484134; PubMed Central PMCID: PMC3525980.
View Article
PubMed/NCBI
Google Scholar

[15] View Article

[16] PubMed/NCBI

[17] Google Scholar

[ref6] 6. Uwimana A, Legrand E, Stokes BH, Ndikumana JM, Warsame M, Umulisa N, et al. Emergence and clonal expansion of in vitro artemisinin-resistant Plasmodium falciparum kelch13 R561H mutant parasites in Rwanda. Nat Med. 2020;26(10):1602–8. Epub 20200803. pmid:32747827; PubMed Central PMCID: PMC7541349.
View Article
PubMed/NCBI
Google Scholar

[19] View Article

[20] PubMed/NCBI

[21] Google Scholar

[ref7] 7. Surendran SN, Sivabalakrishnan K, Sivasingham A, Jayadas TTP, Karvannan K, Santhirasegaram S, et al. Anthropogenic Factors Driving Recent Range Expansion of the Malaria Vector Anopheles stephensi. Front Public Health. 2019;7:53. Epub 20190314. pmid:30923705; PubMed Central PMCID: PMC6426791.
View Article
PubMed/NCBI
Google Scholar

[23] View Article

[24] PubMed/NCBI

[25] Google Scholar

[ref8] 8. Sinka ME, Bangs MJ, Manguin S, Chareonviriyaphap T, Patil AP, Temperley WH, et al. The dominant Anopheles vectors of human malaria in the Asia-Pacific region: occurrence data, distribution maps and bionomic précis. Parasit Vectors. 2011;4:89. Epub 20110525. pmid:21612587; PubMed Central PMCID: PMC3127851.
View Article
PubMed/NCBI
Google Scholar

[27] View Article

[28] PubMed/NCBI

[29] Google Scholar

[ref9] 9. WHO. WHO initiative to stop the spread of Anopheles stephensi in Africa, 2023 update. Available from: https://www.who.int/publications/i/item/WHO-UCN-GMP-2022.06.
View Article
Google Scholar

[31] View Article

[32] Google Scholar

[ref10] 10. Yared S, Gebressielasie A, Damodaran L, Bonnell V, Lopez K, Janies D, et al. Insecticide resistance in Anopheles stephensi in Somali Region, eastern Ethiopia. Malar J. 2020;19(1):180. Epub 20200512. pmid:32398055; PubMed Central PMCID: PMC7216317.
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref11] 11. Syafrudin M, Kristanti RA, Yuniarto A, Hadibarata T, Rhee J, Al-Onazi WA, et al. Pesticides in Drinking Water-A Review. Int J Environ Res Public Health. 2021;18(2). Epub 20210108. pmid:33430077; PubMed Central PMCID: PMC7826868.
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref12] 12. Zug R, Hammerstein P. Still a host of hosts for Wolbachia: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One. 2012;7(6):e38544. Epub 20120607. pmid:22685581; PubMed Central PMCID: PMC3369835.
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref13] 13. Shaw WR, Marcenac P, Childs LM, Buckee CO, Baldini F, Sawadogo SP, et al. Wolbachia infections in natural Anopheles populations affect egg laying and negatively correlate with Plasmodium development. Nat Commun. 2016;7:11772. Epub 20160531. pmid:27243367; PubMed Central PMCID: PMC4895022.
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref14] 14. Gomes FM, Hixson BL, Tyner MDW, Ramirez JL, Canepa GE, Alves ESTL, et al. Effect of naturally occurring Wolbachia in Anopheles gambiae s.l. mosquitoes from Mali on Plasmodium falciparum malaria transmission. Proc Natl Acad Sci U S A. 2017;114(47):12566–71. Epub 20171107. pmid:29114059; PubMed Central PMCID: PMC5703331.
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref15] 15. Baldini F, Rougé J, Kreppel K, Mkandawile G, Mapua SA, Sikulu-Lord M, et al. First report of natural Wolbachia infection in the malaria mosquito Anopheles arabiensis in Tanzania. Parasit Vectors. 2018;11(1):635. Epub 20181213. pmid:30545384; PubMed Central PMCID: PMC6293665.
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref16] 16. Jeffries CL, Lawrence GG, Golovko G, Kristan M, Orsborne J, Spence K, et al. Novel Wolbachia strains in Anopheles malaria vectors from Sub-Saharan Africa. Wellcome Open Res. 2018;3:113. Epub 20181127. pmid:30483601; PubMed Central PMCID: PMC6234743.
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref17] 17. Niang EHA, Bassene H, Makoundou P, Fenollar F, Weill M, Mediannikov O. First report of natural Wolbachia infection in wild Anopheles funestus population in Senegal. Malar J. 2018;17(1):408. Epub 20181106. pmid:30400987; PubMed Central PMCID: PMC6219158.
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref18] 18. Walker T, Quek S, Jeffries CL, Bandibabone J, Dhokiya V, Bamou R, et al. Stable high-density and maternally inherited Wolbachia infections in Anopheles moucheti and Anopheles demeilloni mosquitoes. Curr Biol. 2021;31(11):2310–20 e5. Epub 20210414. pmid:33857432; PubMed Central PMCID: PMC8210651.
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref19] 19. Chrostek E, Gerth M. Is Anopheles gambiae a Natural Host of Wolbachia? mBio. 2019;10(3). Epub 20190611. pmid:31186318; PubMed Central PMCID: PMC6561020.
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref20] 20. Bian G, Joshi D, Dong Y, Lu P, Zhou G, Pan X, et al. Wolbachia invades Anopheles stephensi populations and induces refractoriness to Plasmodium infection. Science. 2013;340(6133):748–51. pmid:23661760.
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref21] 21. Hoffmann AA, Montgomery BL, Popovici J, Iturbe-Ormaetxe I, Johnson PH, Muzzi F, et al. Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature. 2011;476(7361):454–7. Epub 20110824. pmid:21866160.
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref22] 22. Kambris Z, Cook PE, Phuc HK, Sinkins SP. Immune activation by life-shortening Wolbachia and reduced filarial competence in mosquitoes. Science. 2009;326(5949):134–6. pmid:19797660; PubMed Central PMCID: PMC2867033.
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref23] 23. Moreira LA, Iturbe-Ormaetxe I, Jeffery JA, Lu G, Pyke AT, Hedges LM, et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell. 2009;139(7):1268–78. pmid:20064373.
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref24] 24. Bian G, Xu Y, Lu P, Xie Y, Xi Z. The Endosymbiotic Bacterium Wolbachia Induces Resistance to Dengue Virus in Aedes aegypti. PLoS Pathogens. 2010;6(4). pmid:20368968
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref25] 25. Joshi D, Pan X, McFadden MJ, Bevins D, Liang X, Lu P, et al. The Maternally Inheritable Wolbachia wAlbB Induces Refractoriness to Plasmodium berghei in Anopheles stephensi. Front Microbiol. 2017;8:366. Epub 20170308. pmid:28337184; PubMed Central PMCID: PMC5340780.
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref26] 26. Zheng X, Zhang D, Li Y, Yang C, Wu Y, Liang X, et al. Incompatible and sterile insect techniques combined eliminate mosquitoes. Nature. 2019;572(7767):56–61. Epub 20190717. pmid:31316207.
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref27] 27. Crawford JE, Clarke DW, Criswell V, Desnoyer M, Cornel D, Deegan B, et al. Efficient production of male Wolbachia-infected Aedes aegypti mosquitoes enables large-scale suppression of wild populations. Nat Biotechnol. 2020;38(4):482–92. Epub 20200406. pmid:32265562.
View Article
PubMed/NCBI
Google Scholar

[102] View Article

[103] PubMed/NCBI

[104] Google Scholar

[ref28] 28. Nazni WA, Hoffmann AA, NoorAfizah A, Cheong YL, Mancini MV, Golding N, et al. Establishment of Wolbachia Strain wAlbB in Malaysian Populations of Aedes aegypti for Dengue Control. Curr Biol. 2019;29(24):4241–8 e5. Epub 20191121. pmid:31761702; PubMed Central PMCID: PMC6926472.
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref29] 29. Ryan PA, Turley AP, Wilson G, Hurst TP, Retzki K, Brown-Kenyon J, et al. Establishment of wMel Wolbachia in Aedes aegypti mosquitoes and reduction of local dengue transmission in Cairns and surrounding locations in northern Queensland, Australia. Gates Open Research. 2020;3:1547. Epub 20200408. pmid:31667465; PubMed Central PMCID: PMC6801363.
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref30] 30. Utarini A, Indriani C, Ahmad RA, Tantowijoyo W, Arguni E, Ansari MR, et al. Efficacy of Wolbachia-Infected Mosquito Deployments for the Control of Dengue. N Engl J Med. 2021;384(23):2177–86. pmid:34107180; PubMed Central PMCID: PMC8103655.
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref31] 31. Vorsino AE, Xi Z. A mass rearing cost calculator for the control of Culex quinquefasciatus in Hawai’i using the incompatible insect technique. Parasit Vectors. 2022;15(1):453. Epub 20221205. pmid:36471389; PubMed Central PMCID: PMC9724328.
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref32] 32. Zhang J, Zhang S, Wang Y, Xu W, Zhang J, Jiang H, et al. Modulation of Anopheles stephensi gene expression by nitroquine, an antimalarial drug against Plasmodium yoelii infection in the mosquito. PLoS One. 2014;9(2):e89473. Epub 20140224. pmid:24586804; PubMed Central PMCID: PMC3933544.
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref33] 33. Xi Z, Khoo CC, Dobson SL. Wolbachia establishment and invasion in an Aedes aegypti laboratory population. Science. 2005;310(5746):326–8. pmid:16224027.
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref34] 34. Zhou W, Rousset F, O’Neil S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc Biol Sci. 1998;265(1395):509–15. pmid:9569669
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref35] 35. Joshi D, McFadden MJ, Bevins D, Zhang F, Xi Z. Wolbachia strain wAlbB confers both fitness costs and benefit on Anopheles stephensi. Parasit Vectors. 2014;7:336. Epub 20140721. pmid:25041943; PubMed Central PMCID: PMC4223616.
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref36] 36. Fried M. Determination of Sterile-Insect Competitiveness. Journal of Economic Entomology. 1971;64:869–72.
View Article
Google Scholar

[138] View Article

[139] Google Scholar

[ref37] 37. Lu P, Bian G, Pan X, Xi Z. Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells. PLoS Negl Trop Dis. 2012;6(7):e1754. Epub 20120724. pmid:22848774; PubMed Central PMCID: PMC3404113.
View Article
PubMed/NCBI
Google Scholar

[141] View Article

[142] PubMed/NCBI

[143] Google Scholar

[ref38] 38. Fraser JE, O’Donnell TB, Duyvestyn JM, O’Neill SL, Simmons CP, Flores HA. Novel phenotype of Wolbachia strain wPip in Aedes aegypti challenges assumptions on mechanisms of Wolbachia-mediated dengue virus inhibition. PLoS Pathog. 2020;16(7):e1008410. Epub 20200729. pmid:32726353; PubMed Central PMCID: PMC7416964.
View Article
PubMed/NCBI
Google Scholar

[145] View Article

[146] PubMed/NCBI

[147] Google Scholar

[ref39] 39. Hughes GL, Vega-Rodriguez J, Xue P, Rasgon JL. Wolbachia strain wAlbB enhances infection by the rodent malaria parasite Plasmodium berghei in Anopheles gambiae mosquitoes. Appl Environ Microbiol. 2012;78(5):1491–5. Epub 20111230. pmid:22210220; PubMed Central PMCID: PMC3294472.
View Article
PubMed/NCBI
Google Scholar

[149] View Article

[150] PubMed/NCBI

[151] Google Scholar

[ref40] 40. Kripa PK, Thanzeen PS, Jaganathasamy N, Ravishankaran S, Anvikar AR, Eapen A. Impact of climate change on temperature variations and extrinsic incubation period of malaria parasites in Chennai, India: implications for its disease transmission potential. Parasit Vectors. 2024;17(1):134. Epub 20240315. pmid:38491547; PubMed Central PMCID: PMC11334410.
View Article
PubMed/NCBI
Google Scholar

[153] View Article

[154] PubMed/NCBI

[155] Google Scholar

[ref41] 41. Ross PA, Wiwatanaratanabutr I, Axford JK, White VL, Endersby-Harshman NM, Hoffmann AA. Wolbachia Infections in Aedes aegypti Differ Markedly in Their Response to Cyclical Heat Stress. PLoS Pathog. 2017;13(1):e1006006. Epub 20170105. pmid:28056065; PubMed Central PMCID: PMC5215852.
View Article
PubMed/NCBI
Google Scholar

[157] View Article

[158] PubMed/NCBI

[159] Google Scholar

[ref42] 42. Ross PA, Hoffmann AA. Continued Susceptibility of the wMel Wolbachia Infection in Aedes aegypti to Heat Stress Following Field Deployment and Selection. Insects. 2018;9(3). Epub 20180630. pmid:29966368; PubMed Central PMCID: PMC6165456.
View Article
PubMed/NCBI
Google Scholar

[161] View Article

[162] PubMed/NCBI

[163] Google Scholar

[ref43] 43. Ross PA, Ritchie SA, Axford JK, Hoffmann AA. Loss of cytoplasmic incompatibility in Wolbachia-infected Aedes aegypti under field conditions. PLoS Negl Trop Dis. 2019;13(4):e0007357. Epub 20190419. pmid:31002720; PubMed Central PMCID: PMC6493766.
View Article
PubMed/NCBI
Google Scholar

[165] View Article

[166] PubMed/NCBI

[167] Google Scholar

[ref44] 44. Mouton L, Henri H, Fleury F. Interactions between coexisting intracellular genomes: mitochondrial density and Wolbachia infection. Appl Environ Microbiol. 2009;75(7):1916–21. Epub 20090130. pmid:19181828; PubMed Central PMCID: PMC2663226.
View Article
PubMed/NCBI
Google Scholar

[169] View Article

[170] PubMed/NCBI

[171] Google Scholar

[ref45] 45. Hien NT, Anh DD, Le NH, Yen NT, Phong TV, Nam VS, et al. Environmental factors influence the local establishment of Wolbachia in Aedes aegypti mosquitoes in two small communities in central Vietnam. Gates Open Res. 2021;5:147. Epub 20220407. pmid:35602266; PubMed Central PMCID: PMC9098883.
View Article
PubMed/NCBI
Google Scholar

[173] View Article

[174] PubMed/NCBI

[175] Google Scholar

[ref46] 46. Pinto SB, Riback TIS, Sylvestre G, Costa G, Peixoto J, Dias FBS, et al. Effectiveness of Wolbachia-infected mosquito deployments in reducing the incidence of dengue and other Aedes-borne diseases in Niterói, Brazil: A quasi-experimental study. PLoS Negl Trop Dis. 2021;15(7):e0009556. Epub 20210712. pmid:34252106; PubMed Central PMCID: PMC8297942.
View Article
PubMed/NCBI
Google Scholar

[177] View Article

[178] PubMed/NCBI

[179] Google Scholar

[ref47] 47. Ross PA, Endersby NM, Hoffmann AA. Costs of Three Wolbachia Infections on the Survival of Aedes aegypti Larvae under Starvation Conditions. PLoS Negl Trop Dis. 2016;10(1):e0004320. Epub 20160108. pmid:26745630; PubMed Central PMCID: PMC4706305.
View Article
PubMed/NCBI
Google Scholar

[181] View Article

[182] PubMed/NCBI

[183] Google Scholar

[ref48] 48. Ware-Gilmore F, Sgrò CM, Xi Z, Dutra HLC, Jones MJ, Shea K, et al. Microbes increase thermal sensitivity in the mosquito Aedes aegypti, with the potential to change disease distributions. PLoS Negl Trop Dis. 2021;15(7):e0009548. Epub 20210722. pmid:34292940; PubMed Central PMCID: PMC8297775.
View Article
PubMed/NCBI
Google Scholar

[185] View Article

[186] PubMed/NCBI

[187] Google Scholar

Figures

Abstract

Author summary

Introduction

Methods and materials

Ethics statement

Mosquito colonies

Embryonic microinjection

CI crosses

PCR assay of Wolbachia densities in the whole bodies and different tissues of HP1 line

Immature development

Wing length

Adult longevity

Female fecundity and fertility

Male mating competitiveness assay

Temperature sensitivity studies under laboratory conditions

Statistical analysis

Results

Generation of the HP1 line

CI crosses and Wolbachia densities across whole bodies and different tissues of HP1 mosquitoes

Impact of wPip on the development and body size of HP1 line

Impact of wPip on the longevity of HP1 line

Impact of wPip on the reproduction of HP1 line

Tolerance of HP1 mosquito to high temperatures

Discussion

Supporting information

S1 Table. PCR-screening of wPip infection in the G1 offsprings developed from the nine wPip-positive G0 isofemale lines.

S2 Table. wPip positive rates in the PCR-screening of HP1 line from G1 to G10.

S3 Table. Cytoplasmic incompatibility (CI) between the HP1 line and Hor line.

S1 Fig. Representative PCR results for validation of the perfect wPip maternal transmission in HP1 line at different generations.

S2 Fig. The impact of high temperatures on the immature development of HP1 line and Hor line.

S1 Data. Excel spreadsheet containing, in separate sheets, the underlying numerical data and statistical analysis for Table 2 and Figs 1, 2A, 2D, 2E, 3A–3D, 4A–4D, 5A, 5B, S2A and S2B of the study.

Acknowledgments

References