Cytogenetic characterization and mapping of the repetitive DNAs in Cycloramphus bolitoglossus (Werner, 1897): More clues for the chromosome evolution in the genus Cycloramphus (Anura, Cycloramphidae)

Gislayne de Paula Bueno; Kaleb Pretto Gatto; Camilla Borges Gazolla; Peterson T. Leivas; Michelle M. Struett; Maurício Moura; Daniel Pacheco Bruschi

doi:10.1371/journal.pone.0245128

Abstract

Cycloramphus bolitoglossus (Werner, 1897) is a rare species with a low population density in the Serra do Mar region of Paraná and Santa Catarina, in southern Brazil. Currently, it has been assigned to the Near Threatened (NT) category in the Brazilian List of Endangered Animal Species. Here, we described the karyotype of this species for the first time and investigated the patterns of some repetitive DNA classes in the chromosomes using molecular cytogenetic approaches. We isolated, sequenced and mapped the 5S rDNA and the satellite DNA PcP190 of C. bolitoglossus, as well as mapped the telomeric sequences and seven microsatellites motifies [(GA)₁₅, (CA)₁₅, (GACA)₄, (GATA)₈, (CAG)₁₀, (CGC)₁₀, and (GAA)]₁₀. Cycloramphus bolitoglossus has 2n = 26 chromosomes and a fundamental number (FN) equal to 52, with a highly conserved karyotype compared to other genus members. Comparative cytogenetic under the phylogenetic context of genus allowed evolutionary interpretations of the morphological changes in the homologs of pairs 1, 3, and 6 along with the evolutionary history of Cycloramphus. Two subtypes of 5S rDNA type II were isolated in C. bolitoglossus genome, and several comparative analysis suggests mixed effects of concerted and birth-and-death evolution acting in this repetitive DNA. The 5S rDNA II subtype “a” and “b” was mapped on chromosome 1. However, their different position along chromosome 1 provide an excellent chromosome marker for future studies. PcP190 satellite DNA, already reported for species of the families Hylidae, Hylodidae, Leptodactylidae, and Odontophrynidae, is scattered throughout the C. bolitoglossus genome, and even non-heterochromatic regions showed hybridization signals using the PcP190 probe. Molecular analysis suggests that PcP190 satellite DNA exhibit a high-level of homogenization of this sequence in the genome of C. bolitoglossus. The PcP190 satDNA from C. bolitoglossus represents a novel sequence group, compared to other anurans, based on its hypervariable region. Overall, the present data on repetitive DNA sequences showed pseudogenization evidence and corroborated the hypothesis of the emergence of satDNA from rDNA 5S clusters. These two arguments that reinforced the importance of the birth-and-death evolutionary model to explain 5S rDNA patterns found in anuran genomes.

Citation: Bueno GdP, Gatto KP, Gazolla CB, Leivas PT, Struett MM, Moura M, et al. (2021) Cytogenetic characterization and mapping of the repetitive DNAs in Cycloramphus bolitoglossus (Werner, 1897): More clues for the chromosome evolution in the genus Cycloramphus (Anura, Cycloramphidae). PLoS ONE 16(1): e0245128. https://doi.org/10.1371/journal.pone.0245128

Editor: Maykon Passos Cristiano, Universidade Federal de Ouro Preto, BRAZIL

Received: July 28, 2020; Accepted: December 22, 2020; Published: January 13, 2021

Copyright: © 2021 Bueno et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting information files.

Funding: The author(s) received no specific funding for this work.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Frogs of the genus Cycloramphus Tschudi, 1838 are charismatic anurans restricted to the Brazilian Atlantic forest domain, with the most remarkable species richness associated with southern and southeastern highlands of Brazil. The genus is composed of 28 species [1], many of which have limited geographic ranges. Cycloramphus bolitoglossus (Werner, 1897) is a rare species with a low population density in the Serra do Mar region of Paraná and Santa Catarina, in southern Brazil. This poorly-known species is currently classified as Data Deficient (DD) by the International Union for Conservation of Nature [2, 3], although it has been assigned to the Near Threatened (NT) category in the Brazilian List of Endangered Animal Species [4].

Ten Cycloramphus species have been investigated cytogenetically, and most of the available data are limited to conventional karyotype descriptions using C-banding and silver impregnation [5–8]. The diploid number (2n = 26) is conserved in all the species, with karyotypes that are generally composed of metacentric and submetacentric pairs. Little variation has been identified in the fundamental number (FN), with FN = 50 in C. boraceiensis Heyer, 1983, C. dubius (Miranda-Ribeiro, 1920), C eleutherodactylus (Miranda-Ribeiro, 1920), and FN = 52 in C. lutzorum Heyer, 1983, C. fuliginosus Tschudi, 1838, C. acagatan Tschudi, 1838, C. brasiliensis (Steindachner, 1864), C. carvalhoi Heyer, 1983, C. rhyakonastes Heyer, 1983, and C. asper Werner, 1899 [5–8]. Pericentromeric inversions or translocations are the primary sources of karyotype variation in this group [5, 7]. The inclusion of new chromosomal markers with a phylogenetic approach to the analysis of the cytogenetic characteristics of the genus Cycloramphus [9] should contribute to the understanding of the mechanisms of chromosomal evolution that have molded the karyotypes of this genus.

Repetitive DNAs are excellent chromosomal markers for comparative genomics at the chromosome level [10]. The 5S rDNA is an in tandem repeated multigene family in the genome, and it has been widely used in chromosome studies [11]. It consists of a coding sequence of 120 base pairs (bps) followed by a non-transcribed spacer (NTS) of variable size and composition [11, 12]. The coding sequence contains an internal control region (ICR) composed of some elements characterized as box A, an intermediate element (IE), and box C, with some variation being found among the different taxa in which this multigene family has already been studied [11–13].

The highly conserved nature of the 5S rDNA found among distantly related taxa has been confirmed in innumerable studies. The concerted evolution model proposes that a modification in a nucleotide position can be spread from one repeat unit to another through a process of homogenization [11, 14]. However, evolutionary mechanisms related to the Birth-and-Death theory have also been reported in this multigene family [15–18]. This is due to changes in nucleotide sequences through insertions, deletions, association with transposable elements, and the amplification of microsatellites, which cause the loss of regulatory regions, leading to a pseudogenization process [18, 19]. A mixed model of Concerted and Birth-and-death evolution has also been proposed to explain the evolution of this multigene family [19–21]. In amphibians, these processes may account for the emergence of new types of repetitive DNA sequences, such as the PcP190 satellite DNA (satDNA) family [22].

The PcP190 is a satDNA derived from the 5S rDNA, and up to now, it has been found in the genomes of some anuran species of the families Hylidae, Hylodidae and Leptodactylidae, and Odontophrynidae [10, 22–27]. The presence of this satDNA in different evolutionary branches of the Amphibian tree of life has stimulated considerable interest in the evolutionary significance of this repetitive sequence in the genome [10].

Short repetitive DNAs, such as microsatellites repeats, are also spread among the vertebrate genome and provide important insights into chromosomal evolution. Microsatellite repeats correspond to monomeric units of 2–7 bps [28–30], with the head-to-tail organization of a large number of repetitions in a chromosomal cluster. The chromosomal mapping of these sequences has provided a useful marker for comparing karyotypes in chromosomal evolution [31–35].

Here, we provide the first description of the karyotype of C. bolitoglossus based on both conventional and molecular cytogenetic methods, and we extend the known occurrence of the PcP190 satDNA to the family Cycloramphidae. We analyze the cytogenetic data available for the genus Cycloramphus in the context of the phylogenetic relationships of the genus [9] to understand the chromosome shifts that have occurred during the evolutionary history of this group. We also discuss the interplay among the 5S rDNA, microsatellite motifs, the PcP190 satDNA, and the potential for applying these features as cytogenetic markers in the genus Cycloramphus.

Materials and methods

Biological samples and classical cytogenetic analysis

Four C. bolitoglossus specimens (three males and one female) were caught from Pico do Marumbi State Park (25°29’23” S; 48°58’37” W) in the municipality of Piraquara, Paraná state, southern Brazil. Specimen collection was authorized by the Brazilian Institute for the Environment and Natural Resources (IBAMA, Instituto Brasileiro do Meio Ambiente e Recursos Naturais: process number 10277–1), and the Paraná State Environment Institute (IAP/Instituto Ambiental do Paraná: process number 3716). The tissue samples were extracted from the specimens after they had been euthanized through the application of 5% Lidocaine to the skin, to minimize abnormal suffering, following the recommendations of the Herpetological Animal Care and Use Committee (HACC) of the American Society of Ichthyologists and Herpetologists (available at: http://www.asih.org/publications), and approved by SISBIO/Chico Mendes Institute for the Conservation of Biodiversity (collecting license number 10277–1). Voucher specimens (MHNCI 11013–11016) were deposited in the Capão da Imbuia Natural History Museum in Curitiba, Brazil.

Chromosome preparations were obtained from intestinal epithelial cell suspensions, according to King and Rofe [36] and Schmid [37]. The chromosomes were stained with 10% Giemsa and silver impregnation was based on the Ag-NOR method described by Howell and Black [38]. To define the heterochromatic pattern, the chromosomes were submitted to C-banding techinique, following Sumner [39]. To better visualize the heterochromatic blocks, the chromosomes were stained with a 0.4 μg/mL solution of DAPI fluorochrome (6-diamidino-2-phenylindole) following the C-banding. Ten metaphases of two individuals were analyzed with Drawid 0.26 software [40] and chromosomes were ordered and classified by their centromeric position using the nomenclature proposed by Green and Session [41].

Isolation of the 5S rDNA and PcP190, cloning, and molecular characterization

The genomic DNA was extracted from samples of liver and muscle tissue of all specimens (MHNCI 11013–11016) using the TNES method, according to Bruschi et al. [42]. The integrity and quality of the material were verified by electrophoresis and it was quantified using NanoDrop^™ 2000/2000c spectrophotometers (Thermo Fischer Scientific, Waltham, USA). The 5S rDNA was amplified using the Polymerase Chain Reaction (PCR) based on 30ng/uL of the DNA template, 1x PCR buffer (200 mM Tris-HCl (pH 8.4), 500 mM KCl), 1.5 mM of MgCl₂, 0.3 mM of dNTP, 5 U/μL of Taq polymerase, and 0.5 μM of each primer in a reaction with 15 μL. The 5S rDNA was isolated using the primers 5S-A (5’–TACGCCCGATCTCGTCCGATC—3’) and 5S-B (5’—CAGGCTGGTATGGCCGTAAGC—3’) [43]. The PcP190 satDNA was isolated using primers P190F (5’- AGACTGGCTGGGAATCCCAG—3’) and P190R (5’—AGCTGCTGCGATCTGACAAGG—3’), also with the reaction protocol described above [22]. The amplification program was 94°C for 5 minutes, followed by 30 cycles of 94°C for 1 minute; 56°C for 5S rDNA and 60°C for satDNA PcP190 for 50 seconds; 72°C for 1 minute, and a final extension with 72°C for 8 minutes. The amplicons were purified using Wizard^® SV Gel and the PCR Clean-Up System kit (Promega Corporation, Madison, USA), according to the manufacturer’s instructions. The amplicons were cloned using the CloneJET PCR Cloning kit (ThermoFisher Scientific, Waltham, USA), and the vectors were used to transform Escherichia coli TOP10. After plasmidial extraction [44], we used the clones for PCR amplification, using the primers of the vector kit (forward: 5’- CGACTCACTATAGGGAGAGCGGC—3’ and reverse: 5’- AAGAACATCGATTTTCCATGGCAG—3’).

The DNA was sequenced bidirectionally using the Big Dye Terminator kit (Applied Biosystems, Foster City, USA), according to the manufacture’s recommendations and sequenced in an ABI/Prism automatic sequencer (Applied Biosystems, Foster City, USA). The sequences were inspected and edited in Bioedit software 7.2.5 [45].

The rDNA 5S and PcP190 nucleotide sequences obtained in the present study were compared with sequences of other anurans available in the GenBank (NCBI) database (for GenBank accession numbers, see S1 and S2 Tables). These sequences were aligned using the MUSCLE algorithm [46] in MEGA X [47], and the similarity analysis was run in MEGA X by pairwise distance computation using the p-distance method. Similarity comparisons were conducted among four groups of sequences. Among the four groups, here are comparisons using only sequences isolated from C. bolitoglossus. Other comparisons sequences recovered from C. bolitoglossus were compared with sequences of other anurans from GenBank. From this, the following groups were established: (a) only the 5S rDNA sequences recovered from C. bolitoglossus, (b) presumable 5S rDNA transcribed regions from C. bolitoglossus and all 5S rRNA gene sequences of anurans available on GenBank; (c) all the completely conserved regions of the PcP190 satDNA monomers of C. bolitoglossus and sequences already available on GenBank for this satDNA, and (d) the presumable 5S rDNA transcribed region with the conserved region of PcP190 satDNA of C. bolitoglossus and other anurans available on GenBank.

A Maximum Likelihood tree was estimating using RAxML version 8.0.0 [48] (with the Kimura-2-parameter model with the gamma distribution heterogeneity across sites to delimit the groups of sequences for pairwise comparisons to define the types and subtypes of rDNA 5S. All the sequences generated in the present study were deposited in GenBank (accession numbers: MT920589—MT920617).

Fluorescent in situ hybridization assays (FISH)

The 5S rDNA clones CB5STIIa.C1 and CB5STIIb.C7 were labeled by PCR using digoxigenin 11-dUTP (Roche, Mannheim, Germany). The probes for PcP190 satDNA (clone C7M2.PcP) were labeled with Biotin-16-dUTP using the Biotin Nick Translation Mix (Roche, Mannheim, Germany). These probes were precipitated in the presence of sonicated salmon sperm DNA (100 ng/μL), with 3M sodium acetate and ethanol. The cocktail of probes used for the resuspension was prepared with 50% of formamide, 10% of dextran sulfate, and 2x SSC. The probe solutions were applied to the slides with the chromosome preparations after denaturation at 95°C for 10 minutes. The slides were incubated for 72 hours at 37°C following the protocol described by Pinkel et al. [49]. The digoxigenin probe was detected using an anti-digoxigenin antibody conjugated with rhodamine (Roche, Mannheim, Germany). The biotin-labeled probes were detected using streptavidin conjugated with Cy3 (Invitrogen, Carlsbad, USA).

We mapped the microsatellite motifs (GA)₁₅, (CA)₁₅, (GACA)₄, (GATA)₈, (CAG)₁₀, (CGC)₁₀, and (GAA)₁₀ using oligonucleotide probes marked directly with Cy5- fluorochrome (Sigma-Aldrich, St. Louis, USA) at the 5’ end during their synthesis. The telomeric (TTAGGG)n probes were produced by PCR amplification using the telomeric primers F (5’ TTAGGG 3’) and R (5’ CCCTAA 3’) marked directly by the incorporation of 11-digoxigenin-dUTP, following the protocol described by Guerra [50].

The FISH experiments with microsatellite probes followed the protocol described by Kubat et al. [51], while the telomeric sequences were mapped using the procedures described by Ernetti et al. [52]. The chromosome preparations were counterstained with DAPI (0.4μg/mL). The images were captured using a Nikon confocal A1R MP microscope and an Olympus BX51 fluorescence microscope, and edited using Adobe Photoshop CS4 only for brightness and contrast.

Results

Description of the karyotype and the chromosomal mapping of the microsatellites and telomeric repeats

Cycloramphus bolitoglossus has 2n = 26 chromosomes with a karyotype composed of eleven metacentric pairs (1, 4, 5, 6, 7, 8, 9, 10, 11, 12 and 13) and two submetacentric pairs (2 and 3) with FN = 52 (Fig 1A and S3 Table). A secondary constriction was observed in an interstitial region of the long arm of pair 6, coinciding with the NOR site detected by the Ag-NOR method (Fig 1B). Heterochromatin, using C-band+DAPI procedure, was observed in pericentromeric blocks in the homologs of pairs 1, 3, 4, and 7, while in pairs 1 and 4, constitutive heterochromatin blocks were observed in both chromosome arms (Fig 1C). Pairs 3 and 7 presented signals only in the long arms. Additional C-bands+DAPI were detected in an interstitial position in the long arms of the homologs of pairs 8 and 10 (Fig 1C). Negative DAPI staining was also observed in pair 6, coinciding with the secondary constriction (Fig 1C).

Download:

Fig 1. Karyotype features and microsatellite motifs of Cycloramphus bolitoglossus.

Classical cytogenetic features are shown by Giemsa staining (A), location of the NORs, revealed by silver impregnation (B), and the heterochromatin revealed by C-banding + DAPI staining (C). Molecular cytogenetic mapping of the telomeric probe (D) and microsatellite motifs (GA)₁₅ (E), (GATA)₈ (F). and (GACA)₄ (G). Bar: 5μm.

https://doi.org/10.1371/journal.pone.0245128.g001

The telomeric probe hybridized all the telomeres found in the chromosomes (Fig 1D). Interstitial telomeric sequences (ITSs) were detected in the pericentromeric regions of the short arms of the homologs of pairs 1, 2, 7, and 10, and on the long arms of pairs 4 and 5. The FISH assays using microsatellite repeats (GA)₁₅ detected conspicuous hybridization signals in the terminal regions of the homologs of pair 1, as well as in a centromeric position of pairs 1, 2 and 9 (Fig 1E). Hybridization signals of the (GA)₁₅ probe were also observed in the terminal regions of pairs 2, 7, 8, 9, 10, and 12, in the terminal regions of pairs 3, 4 and 5 (Fig 1E). A strong signal was also observed in the long arm of pair 11 (Fig 1E). Pair 6 did not show hybridization signals with (GA)₁₅ probe (Fig 1E). Chromosome 1 presented hybridization signals of the (GATA)₈ probe in the terminal region of the long arm and terminal region of all chromosome pairs (Fig 1F). The location of the (GACA)₄ repeat coincided with the heterochromatic block in the centromere of chromosome 1 and in the euchromatic portion of the terminal region of its long arm, coinciding with the (GA)₁₅ signals (Fig 1G). Additional marks of this microsatellite were found in the terminal regions of all pairs, except 11 and 12 (Fig 1G). No hybridization signals were observed for the (CAG)₁₀, (CGC)₁₀, and (GAA)₁₀ microsatellite probes in this karyotype.

Molecular analysis of the 5S rDNA of Cycloramphus bolitoglossus

The PCRs recovered two fragments of approximately 400 bps and 500 bps, with 12 recombinant colonies. All the cloned sequences were classified as the rDNA 5S type II, based on the BLAST searches of the NCBI nucleotide database, the similarity analysis with the 5S rRNA gene of other anurans (Table 1). Given the numerous differences in the C. bolitoglossus sequences, however, we classified them into two subtypes, IIa and IIb.

Download:

Table 1. rDNA 5S genetic similarity.

https://doi.org/10.1371/journal.pone.0245128.t001

The 5S type IIa is the smaller of the two sequences (CB5STIIa.C1), which has 393 bps, including 120 bps that correspond to the coding sequence of the 5S rDNA gene and an NTS region containing 273 bps. The presumable transcribed region contains complete internal control regions, box A, intermediate element, and box C (Fig 2A). Eight sequences (CB5STIIb.C1-CB5STIIb.C4 and CB5STIIb.C6-C9) were identified as subtype “b”, and contain 498 bps, with the first 120 bps corresponding to the complete coding sequence of the 5S rDNA gene (including all internal regulatory elements) and an NTS region containing 378 bps (Fig 2B). We also recovered two cloned sequences. We designated CB5SPG (Fig 2C) and subsequently identified asthe PcP190 satDNA based on the BLAST searches of the NCBI sequence database and in our alignment with 5S rDNA and PcP190 SatDNA sequences from C. bolitoglossus (Fig 2D).

Download:

Fig 2. 5S rDNA alignments.

Sequence alignments of the 5S rDNA clones obtained from C. bolitoglossus CB5STII.a (A), CB5STII.b (B), and CB5SPG (C). In D, CB5SPG is aligned with CB5STII.a, CB5STII.b, and the PcP190 satDNA. The primer annealing sites of 5S-A are highlighted as blue arrows whereas the PcP190 satDNA primer sites are highlighted as green arrows. The internal control regions of the 5S rDNA gene are shaded in purple in A and B.

https://doi.org/10.1371/journal.pone.0245128.g002

The nucleotide sequences of the presumable transcribed region (120 bps) of the 5S rDNA subtypes IIa and IIb diverge only slightly, with a mean similarity of 91.10% between them (Table 1). When sequences of this region, isolated from C. bolitoglossus, were compared with those of other anurans (Table 1), CB5STIIa presented the lowest similarities, ranging from 39.45% (with the Pseudis tocantins 5S I rRNA gene) to just under 80% in the case of Engystomops freibergi 5S rRNA gene type II. In contrast, the CB5STIIb sequence was just over 90% similar to the latter sequence (Table 1).

The Maximum Likelihood analysis grouped all the 5S rRNA gene sequences of C. bolitoglossus within a group with all the type II 5S rDNAs of P. cuvieri, Engystomops, and Pseudis tocantins. However, the CB5STIIa sequence was more divergent (Fig 3).

Download:

Fig 3. 5S rDNA Maximum Likelihood analysis.

Arrangement derived from the Maximum Likelihood analysis of the 5S rRNA gene sequences of Cycloramphus bolitoglossus and other anurans obtained from GenBank.

https://doi.org/10.1371/journal.pone.0245128.g003

The chromosomal mapping of 5S rDNA subtype IIa (using the CB5STIIa.C1 clone) and subtype IIb (using the CB5STIIb.C1 clone) found distinct hybridization signals in two chromosomes pairs of male individuals of C. bolitoglossus (Fig 4A). The CB5STIIa.C1 probe detected a signal in the centromeric region of the homologs of pairs 1 and 4 (Fig 4B). In contrast the CB5STIIb probe detected clusters of signals in the terminal region of the long arms of the homologs of pair 1 (Fig 4A).

Download:

Fig 4. Chromosomal mapping.

A. Location of CB5STII.b in the long arms of pair 1. B. Hybridization signal of CB5STIIa. C. Mapping of PcP 190 SatDNA. D. Comparative hybridization signals in chromosome pair 1 of Cycloramphus bolitoglossus. Bar: 5μm.

https://doi.org/10.1371/journal.pone.0245128.g004

PcP190 satDNA identification reveals chromosome spreading in the C. bolitoglossus karyotype

The PCRs generated distinct bands ranging in length from 200 bps to 700 bps. The cloning produced nine recombinant clones, with four of these nine cloned sequences being composed of three monomers (607 bps) with juxtaposed sequences, while one clone presented one complete and one partial monomer (313 bps), and the other four recovered the partial PcP190 monomer (198 bps). All the monomers isolated in the same cloned sequence share an even higher mean level of similarity (95.54%). We recognized conserved (CR) and hypervariable (HR) regions, based on the classification of Gatto et al. [25] (Fig 5).

Download:

Fig 5. PcP190 satDNA alignment.

Sequence alignment of the PcP190 satDNA clones obtained from the C. bolitoglossus genome (purple box) with the sequences from other anurans. Primer annealing sites are highlighted (green), as are conserved (blue) and hypervariable (pink) regions. The CR of the PcP190 of C. bolitoglossus was highly similar among the intragenomic monomers and in comparison with other anuran species (> 77%) deposited in GenBank (S4 Table). As expected, the HR presented low nucleotide variation at the intragenomic level (94.86%) (S4 Table), but high levels of variation in compared with the HRs of the other anurans included in the matrix.

https://doi.org/10.1371/journal.pone.0245128.g005

Finally, we analyzed the similarity of the conserved region of the 5S rDNA clones and the CRs of the PcP clones of C. bolitoglossus. The cloned CB5STIIb sequences were almost 60% similar to the CR of the PcP190 satDNA (S4 Table), although CB5STIIa was less similar, at 42.37%. The PcP190 satDNA probe produced highly scattered signals, with hybridization sites identified in the centromeric and telomeric regions of pairs 1, 2, and 4, and in the telomeric region of pairs 7, 8, 9, 10, 11, 12, and 13 (Fig 4C). In Fig 4D, we emphasized all hybridization marks found in pair 1.

Discussion

Insights into the evolution of the Cycloramphus species chromosomes

The karyotype of C. bolitoglossus, described here, presents a highly conserved diploid number of 2n = 26 chromosomes, as reported previously in other cycloramphids [5–8, 53]. Despite this conserved diploid number, interspecific variation in the fundamental number (FN = 50 or 52) indicates that intrachromosomal rearrangements may have played a central role in this genus chromosomal diversification.

The most comprehensive phylogenetic reconstruction of the genus Cycloramphus [9] found evidence of independent, recurrent events of change in the FN (Fig 6). If this hypothesis is correct, several pericentromeric inversions should be found in the different karyotypes identified in the phylogenetic tree of this genus. Chromosome pair 1 is a potentially good example of this process, given the existence of metacentric and subtelocentric morphology among different karyotypes (Fig 6).

Download:

Fig 6. Phylogenetic reconstruction of the genus Cycloramphus.

The hypothesis of the evolutionary chromosomal changes in the Cycloramphus and Zachaenus species, as inferred from the available cytogenetic data [5–8, 53] in the phylogeny of the genus presented by de Sá et al. [9]. Events of character transformation are indicated: (a) centromere repositioning in chromosome pair 1 of C. fuliginosus; (b) repositioning of the NOR from pair 6 to pair 1 in C. acangatan; (c) pericentromeric inversion in pair 6 of the common ancestor of the C. boraceiensis linages and C. dubius and (d’ or d”) a centromere repositioning in the chromosome 13 in the common ancestor of C. eleutherodactylus lineages L2, L3 and L4, C. carvalhoi, C. stejnegeri and C. acangatan, or independent repositioning in the lineages that gave rise to C. eleutherodactylus L4, C. carvalhoi and C. acangatan. The d’ and d” events are equally parsimonious hypothesis (indicated by grey arrows) given the available cytogenetic data for the genus Cycloramphus. Red circles indicate the NORs positions, Gray circles indicate the presence of secondary constrictions, and black regions indicate heterochromatin areas of the chromosomes.

https://doi.org/10.1371/journal.pone.0245128.g006

When we adjusted the chromosome morphology of pair 1 to the phylogenetic inferences of de Sá et al. [9], we found evidence that this metacentric pair is the plesiomorphic condition in Cycloramphus. This conclusion is supported by the fact that pair 1 is metacentric in Thoropa taophora (the outgroup) [T. miliaris in 53] and Zachaenus carvalhoi [54, 55], and that this morphology is retained in Cycloramphus brasiliensis, C. bolitoglossus, C. carvalhoi, C. eleutherodactylus, C. acangatan, C. boraceiensis, C. dubius, C. lutzorum, and C. rhyakonastes [7, 54]. Given this evidence, the most parsimonious hypothesis to account for these morphological changes in the homologs of pair 1 would involve centromeric reposition events that modified the plesiomorphic (metacentric) condition, which would have occurred in the lineage that gave rise to C. fuliginosus [7].

Heterochromatic blocks are located in the pericentromeric regions of all the C. bolitoglossus chromosomes. However, C. bolitoglossus is different from the other congeners that have been karyotyped due to interstitial C-positive bands in the long arms of chromosomes 8 and 10. By contrast, C. bolitoglossus and C. brasiliensis do share a large amount of pericentromeric heterochromatin in the long arm of pair 3 [7], which indicate homology of pair 3 between these two species. Unfortunately, no C-banding data are available for C. fuliginosus, C. migueli, and C. bandeirensis. The collection of these data for these species would help resolve the homology hypothesis in pair 3 of these species.

Changes in the morphology of pairs 6 and 13 also appear to have involved centromeric reposition, resulting in variation in the metacentric or subtelocentric/telocentric morphology among the different species [7]. However, except C. acangatan and C. fuliginosus, all the Cycloramphus species that have been karyotyped to date [7, 53], including C. bolitoglossus, have rDNA 45S sites in pair 6, detected by Ag-NOR method. The rDNAs are considered a hotspot of rearrangement [56], which may account for the changes observed in this chromosome pair among this genus species.

The chromosomal mapping of the repetitive DNA in the C. bolitoglossus karyotype permitted the assessment of these chromosomal changes from a new perspective. Our mapping data reveal the presence of rDNA 5S subtype IIa and satDNA PcP190 in chromosome pair 1 in addition to the enrichment of the microsatellite motifs [(GA), (GACA) and (GATA)] and the presence of interstitial telomeric sequences (ITSs) in this pair. Microsatellites are typically associated with regions that have high recombination rates, and it is thought that the microsatellites (GA)₁₅ and (GACA)₄ are related to the stabilization of the ribosomal DNA sequences [29]. Given this, the comparative cytogenetics of Cycloramphus revealed an unexpected model for the investigating of the role of the repetitive DNAs in the intrachromosomal rearrangements observed in the present study.

Recurrent association between satDNA PcP190 and rDNA 5S in the Anura: Additional evidence

We recorded satDNA PcP190 in the family Cycloramphidae for the first time, expanding the known occurrence of this family of satDNA in the anuran genome. The PcP190 sequences of C. bolitoglossus were most similar to the first 120 bps of the other anuran PcP190 sequences, consistent with the conserved domain (CR) already reported for this satDNA family [23–25]. A hypervariable region was also recognized within the PcP190 monomer that did not match any other PcP190 deposited in GenBank. Given this, we suggest that the PcP190 of C. bolitoglossus represents a new type of sequence of this satDNA family, denominated as PcP190-Cbol-1.

When we compared the satDNA PcP190 among the anuran species in which this sequence has already been reported, several similar patterns can be observed in this repetitive DNA, including (i) high intra- and intergenomic levels of similarity, (ii) the chromosomal distribution in the FISH assays, and (iii) the recurrence of associations with the 5S rDNA chromosomal clusters. Firstly, despite the dispersal of the PcP190-Cbol-1 satDNA copies among the C. bolitoglossus chromosomes, we recovered an unexpectedly high degree of nucleotide similarities among the cloned sequences in both the CR and the HR. The high level of homogenization observed in the C. bolitoglossus genome may reflect the influence of the concerted evolution model for this repetitive DNA or a single recent event of expansion in this genome [57, 58]. It may also be possible that the PCR isolated only highly homogeneous sequences from the heterochromatic regions because they are more abundant. It is interesting to note that, in C. bolitoglossus, the FISH mapped the PcP190-Cbol-1 satDNA in the euchromatic areas. This was unexpected because the satDNA elements distributed in euchromatic domains tend to be more widely dispersed then those located in heterochromatic regions [59].

The chromosomal mapping of satDNA PcP190 in anuran karyotypes typically reveals a long array of juxtaposed monomeric units in the genome, located primarily in the heterochromatic regions [22, 24], as detected in the terminal and/or (peri)centromeric regions of the C. bolitoglossus chromosomes with a probe for PcP190-Cbol-1. This repetitive DNA has also been mapped in the (peri)centromeric heterochromatin of several Physalaemus species [22, 23, 60] and a heterochromatic block of the W chromosome of Pseudis tocantins [24]. Thus, the occurrence of the PcP190 in heterochromatin regions is common and broadly expected.

However, our FISH assays also revealed PcP190-Cbol-1 satDNA in the euchromatic regions of the C. bolitoglossus chromosomes, a situation that was not found in any other species investigated so far that possess PcP190 satDNA [23–25]. A similar pattern has already been detected to the satDNA families in the karyotypes of Drosophila melanogaster Meigen 1830 [61] and the red flour beetle, Tribolium castanaeum Herbst 1797 [62], including the transcriptional regulation of genes associated with the euchromatic arrays of the TCAST1 satDNA, which modulate gene expression under stress in T. castanaeum [63]. The functional significance of the PcP190 satDNA has never been verified in the anuran genomes. However, the highly conserved sequence found in numerous distantly-related species of the Hyloidea superfamily supports the hypothesis that the PcP190 satDNA could have a functional role in the hyloid genome [23–25]. Given this, the detection of PcP190 satDNA in euchromatic regions of the C. bolitoglossus chromosomes indicates that this species may represent a potentially valuable model species for verifying the functional role of this satDNA in the future.

As observed in the local association of the 5S rDNA subtype IIa and satDNA PcP190 in the terminal region of chromosome pair 1, the apparent interplay between repetitive classes does not appear to be random. The evolutionary derivation of the satDNA PcP190 found in anurans from the rDNA 5S is supported by the high degree of similarity in the conserved 120 bps of the rDNA gene and the CR of the satDNA. Vittorazzi et al. [22] suggested that the PcP190 of Physalaemus cuvieri originated from the duplication of genes following the divergence and dispersion to new chromosome sites. Similar associations have also been reported in P. ephippifer [23, 64], Engystomops petersi, E. freibergi, and E. cf. magnus [10]. We also detected a similar pattern in the present study, with the major cluster of the PcP190 satDNA coinciding with 5S rDNA subtype IIa in C. bolitoglossus, in addition to signals dispersed in subtelomeric or (peri)centromeric regions of other chromosomes, corroborating the hypothesis of Vittorazzi et al. [22].

Additionally, interesting to note that the 5S rDNA was mapped in chromosome 1 of C. bolitoglossus. In the genus Thoropa (which is closely related to Cycloramphus) the large metacentric chromosome 1 also showed to harbor the 5S rDNA sites in most of the species [53]. Based on this, we may infer that chromosome 1 of C. bolitoglossus might be homologous to chromosome 1 from Thoropa species.

The 5S rDNA analyses of C. bolitoglossus recovered two different sizes of 5S rDNA sequences as found in some other species [17, 65, 66]. The difference between the two products’ molecular weights has been attributed in particular to the differences in the size and composition of the NTS, which is a diversified sequence under low selective pressure, and thus more susceptible to the accumulation of mutations [67]. Despite its potential as a cytogenetic marker, 5S rDNA has been sequenced and mapped in only a few anuran species [65, 68, 69].

The Maximum Likelihood analysis grouped all the C. bolitoglossus 5S rRNA gene sequences in the same cluster, distinct from the 5S rDNA type II of other anurans. This indicates a high degree of homogenization of the 5S rRNA gene in C. bolitoglossus. However, the “a” subtype of the C. bolitoglossus 5S rDNA was more divergent than the “b” subtype in both the maximum likelihood and similarity analyses. This indicates conclusively that the two subtypes may represents distinct evolutionary pathways or even reflect a process of pseudogenization. It has been suggested that multigene families evolve through a birth-and-death model of evolution, which might explain why duplications events often lead to the duplication of copies of a given sequence, which would not evolve in concert with other parental copies, but might become a new gene or even degenerate into a pseudogene [18].

Pseudogenes of the 5S rDNA have already been identified in some ray-finned fish, Actinopterygii [70, 71], human and rat genomes [72, 73]. Some satDNAs sequences are thought to have been derived from 5S rDNA by an ancient pseudogenization process, including the 5S-HindIII in the fish Hoplias malabaricus Bloch 1794 [74], PLsatB in the weed Plantago lagopus Linneaus 1753 [75], and the PcP190 in hyloid anurans [23–26]. In the present study, we used the 5S-A and 5S-B primers of Pendás et al. [43], which are universal primers used to isolate 5S rDNA in vertebrate genomes [21, 24, 67, 70, 71]. However, two cloned sequences (CB5SPG.1 and CB5SPG.2) were highly similar to the PcP190 satDNA sequences in the BLAST searches, indicating that they are, in fact, PcP190 satDNA. These results reinforce the similarities in the 5S rDNA and PcP190 satDNA sequence, given that the primers of Pendas et al. [43] may anneal in the regions of 24–44 bps (5S-A) and 1–21 bps (5S-B) in the PcP190 satDNA copies. Given this, future studies of 5S rDNA in hyloid frogs that use the universal primers of Pendas et al. [43] should pay careful attention after the cloning or sequencing procedures to avoid cross-amplification with PcP190 satDNA. Overall, then, the evidence on pseudogenization and the emergence of satDNA from rDNA 5S clusters, reported here, further reinforce the importance of the birth-and-death evolutionary model to explain the rDNA 5S patterns found in anuran genomes.

Conclusions

The use of novel chromosomal markers provided new perspectives for the investigation of chromosomal evolution in the genus Cycloramphus and suggests, in particular, that repetitive DNAs may have played an important role in karyological diversification without chromosome number changes. Our data shed new light onto the evolutionary interplay between satDNA PcP190 and rDNA 5S in the anuran genome and raise further questions on its evolutionary significance.

Supporting information

S1 Table. 5S rDNA accession numbers.

https://doi.org/10.1371/journal.pone.0245128.s001

(DOCX)

S2 Table. PcP190 satDNA accession numbers.

https://doi.org/10.1371/journal.pone.0245128.s002

(DOCX)

S3 Table. Chromosome measurements.

https://doi.org/10.1371/journal.pone.0245128.s003

(DOCX)

S4 Table. PcP190 SatDNA genetic similarity.

https://doi.org/10.1371/journal.pone.0245128.s004

(DOCX)

Acknowledgments

We thank the Multi-User Confocal Microscopy Center of the Federal University of Paraná for the capture of the images included in this study. We thank the Fundação Grupo O Boticário de Proteção à Natureza and Mater Natura—Instituto de Estudos Ambientais for logistical support in collections.

References

1. Frost DR. Amphibian Species of the World 6.0: An Online Reference [Internet]. 2020 [cited 26 Jun 2020]. http://research.amnh.org/herpetology/amphibia/index.php
2. Heyer WR, Segalla M V, Silvano D, Verdade VK. Cycloramphus bolitoglossus. The IUCN Red List of Threatened Species. 2004. dx.doi.org/10.2305/IUCN.UK.2004.RLTS.T56359A11452397.en
3. Heyer WR, Rand AS, Cruz CAG, Peixoto OL. Decimations, extinctions, and colonizations of frog population in Southeast Brazil and their evolutionary implications. Biotropica. 1988;20: 230–235.
- View Article
- Google Scholar
4. ICMBio. Lista Vermelha das Espécies Ameaçadas [Internet]. Brasilia; 2018. https://www.icmbio.gov.br/portal/images/stories/comunicacao/publicacoes/publicacoes-diversas/livro_vermelho_2018_vol1.pdf
5. Silva APZ, Haddad CFB, Kasahara S. Cytogenetic analysis of Cycloramphus boraceiensis Heyer (Anura, Leptodactylidae). Rev Bras Zool. 2001;18: 111–115.
- View Article
- Google Scholar
6. Beçak ML, Denaro L, Beçak W. Polyploid and mechanisms of karyotypic diversification in Amphibia. Cytogenetics. 1970;9: 225–238. pmid:5474808
- View Article
- PubMed/NCBI
- Google Scholar
7. Noleto RB, Amaro RC, Verdade VK, Campos JRC, Gallego LFK, de Lima AMX, et al. Comparative cytogenetics of eight species of Cycloramphus (Anura, Cycloramphidae). Zool Anz. 2011;250: 205–214.
- View Article
- Google Scholar
8. Lima AMX, Garey M V, Noleto RB, Verdade VK. Natural History of the Lutz’s Frog Cycloramphus lutzorum Heyer, 1983 (Anura: Cycloramphidae) in the Brazilian Atlantic Forest: Description of the Advertisement Call, Tadpole, and Karyotype. J Herpetol. 2010;44: 360–371.
- View Article
- Google Scholar
9. de Sá FP, Haddad CFB, Gray MM, Verdade VK, Thomé MTC, Rodrigues MT, et al. Male-male competition and repeated evolution of terrestrial breeding in Atlantic Coastal Forest frogs. Evolution (N Y). 2020;74: 459–475. pmid:31710098
- View Article
- PubMed/NCBI
- Google Scholar
10. Targueta CP, Vittorazzi SE, Gatto KP, Bruschi DP, Veiga-Menoncello ACP, Recco-Pimentel SM, et al. Anuran Cytogenetics: an overview. In: Norris N, Miller C, editors. An Essential Guide to Cytogenetics. New York, NY: Nova Science Publishers, Inc; 2018. pp. 1–64.
11. Long EO, Dawid IB. Repeated Genes in Eukaryotes. Annu Rev Biochem. 1980;49: 727–764. pmid:6996571
- View Article
- PubMed/NCBI
- Google Scholar
12. Martins C, Wasko AP. Organization and Evolution of 5S Ribosomal DNA in the Fish Genome. In: Williams CR, editor. Focus on Genome Research. Hauppauge: Nova Science Publishers, Inc; 2004. pp. 335–363.
13. Vierna J, Wehner S, Höner zu Siederdissen C, Martínez-Lage A, Marz M. Systematic analysis and evolution of 5S ribosomal DNA in metazoans. Heredity (Edinb). 2013;111: 410–421. pmid:23838690
- View Article
- PubMed/NCBI
- Google Scholar
14. López-Flores I, Garrido-Ramos MA. The Repetitive DNA Content of Eukaryotic Genomes. In: Garrido-Ramos MA, editor. Genome Dynamics Repetitive DNA. Basel: Karger; 2012. pp. 1–28.
15. Bardella VB, Cabral-de-Mello DC. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera). Gene. 2018;646: 153–158. pmid:29253608
- View Article
- PubMed/NCBI
- Google Scholar
16. Dimarco E, Cascone E, Bellavia D, Caradonna F. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus. Gene. 2012;508: 21–25. pmid:22967708
- View Article
- PubMed/NCBI
- Google Scholar
17. Rebordinos L, Cross I, Merlo A. High evolutionary dynamism in 5S rDNA of fish: state of the art. Cytogenet Genome Res. 2013;141: 103–113. pmid:24080995
- View Article
- PubMed/NCBI
- Google Scholar
18. Eirín-López JM, Rebordinos L, Rooney AP, Rozas J. The Birth-and-Death Evolution of Multigene Families Revisited. In: Garrido-Ramos MA, editor. Genome Dynamics. 7th ed. Basel: Karger Publishers; 2012. pp. 170–196. https://doi.org/10.1159/000337119 pmid:22759819
19. Nei M, Rooney AP. Concerted and Birth-and-Death Evolution of Multigene Families. Annu Rev Genet. 2005;39: 121–152. pmid:16285855
- View Article
- PubMed/NCBI
- Google Scholar
20. Freire R, Arias A, Ínsua AM, Méndez J, Eirín-López JM. Evolutionary dynamics of the 5S rDNA gene family in the mussel mytilus: mixed effects of birth-and-death and concerted evolution. J Mol Evol. 2010;70: 413–426. pmid:20386892
- View Article
- PubMed/NCBI
- Google Scholar
21. Pinhal D, Yoshimura TS, Araki CS, Martins C. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays. BMC Evol Biol. 2011;11: 151. pmid:21627815
- View Article
- PubMed/NCBI
- Google Scholar
22. Vittorazzi SE, Lourenço LB, Del-Grande ML, Recco-Pimentel SM. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae). Cytogenet Genome Res. 2011;134: 101–107. pmid:21464559
- View Article
- PubMed/NCBI
- Google Scholar
23. Vittorazzi SE, Lourenço LB, Recco-Pimentel SM. Long-time evolution and highly dynamic satellite DNA in leptodactylid and hylodid frogs. BMC Genet. 2014;15: 111. pmid:25316286
- View Article
- PubMed/NCBI
- Google Scholar
24. Gatto KP, Busin CS, Lourenço LB. Unraveling the sex chromosome heteromorphism of the paradoxical frog Pseudis tocantins. PLoS One. 2016;11: e0156176. pmid:27214234
- View Article
- PubMed/NCBI
- Google Scholar
25. Gatto KP, Mattos J V, Seger KR, Lourenço LB. Sex chromosome differentiation in the frog genus Pseudis involves satellite DNA and chromosome rearrangements. Front Genet. 2018;9: 301. pmid:30147705
- View Article
- PubMed/NCBI
- Google Scholar
26. Gatto K, Seger K, Garcia P, Lourenço L. Satellite DNA Mapping in Pseudis fusca (Hylidae, Pseudinae) Provides New Insights into Sex Chromosome Evolution in Paradoxical Frogs. Genes (Basel). 2019;10: 160. pmid:30791490
- View Article
- PubMed/NCBI
- Google Scholar
27. Da Silva M. J., Fogarin Destro R., Gazoni T., Narimatsu H., Pereira dos Santos P. S., Haddad C. F. B., et al. (2020). Great Abundance of Satellite DNA in Proceratophrys (Anura, Odontophrynidae) Revealed by Genome Sequencing. Cytogenetic and Genome Research. pmid:32146462
- View Article
- PubMed/NCBI
- Google Scholar
28. Chistiakov DA, Hellemans B, Volckaert FAM. Microsatellites and their genomic distribution, evolution, function and applications: A review with special reference to fish genetics. Aquaculture. 2006;255: 1–29.
- View Article
- Google Scholar
29. Guo WJ, Ling J, Li P. Consensus features of microsatellite distribution: Microsatellite contents are universally correlated with recombination rates and are preferentially depressed by centromeres in multicellular eukaryotic genomes. Genomics. 2009;93: 323–331. pmid:19146945
- View Article
- PubMed/NCBI
- Google Scholar
30. Tóth G, Gáspári Z, Jurka J. Microsatellites in different eukaryotic genomes: Surveys and analysis. Genome Res. Cold Spring Harbor Laboratory Press; 2000;10: 967–981. pmid:10899146
- View Article
- PubMed/NCBI
- Google Scholar
31. Travenzoli NM, Lima BA, Cardoso DC, Dergam JA, Fernandes-Salomão TM, Lopes DM. Cytogenetic Analysis and Chromosomal Mapping of Repetitive DNA in Melipona Species (Hymenoptera, Meliponini). Cytogenet Genome Res. S. Karger AG; 2019;158: 213–224.
- View Article
- Google Scholar
32. Sassi Oliveira, Bertollo Nirchio, Hatanaka Marinho, et al. Chromosomal Evolution and Evolutionary Relationships of Lebiasina Species (Characiformes, Lebiasinidae). Int J Mol Sci.; 2019;20: 2944. pmid:31208145
- View Article
- PubMed/NCBI
- Google Scholar
33. Scacchetti PC, Utsunomia R, Pansonato-Alves JC, Vicari MR, Artoni RF, Oliveira C, et al. Chromosomal mapping of repetitive DNAs in Characidium (Teleostei, Characiformes): genomic organization and diversification of ZW sex chromosomes. Cytogenet Genome Res. 2015;146: 136–143. pmid:26277929
- View Article
- PubMed/NCBI
- Google Scholar
34. Ruiz-Ruano FJ, Cuadrado Á, Montiel EE, Camacho JPM, López-León MD. Next generation sequencing and FISH reveal uneven and nonrandom microsatellite distribution in two grasshopper genomes. Chromosoma. 2015;124: 221–234. pmid:25387401
- View Article
- PubMed/NCBI
- Google Scholar
35. Pucci MB, Barbosa P, Nogaroto V, Almeida MC, Artoni RF, Scacchetti PC, et al. Chromosomal spreading of microsatellites and (TTAGGG) sequences in the Characidium zebra and C. gomesi genomes (Characiformes: Crenuchidae). Cytogenet Genome Res. 2016;149: 182–190. pmid:27504623
- View Article
- PubMed/NCBI
- Google Scholar
36. King M, Rofe R. Karyotypic variation in the Australian gekko Phyllodactylus marmoratus (Gray) (Gekkonidae: Reptilia). Chromosoma. 1976;54: 75–87. pmid:1248335
- View Article
- PubMed/NCBI
- Google Scholar
37. Schmid M. Chromosome banding in Amphibia. I. Constitutive heterochromatin and nucleolus organizer regions in Bufo and Hyla. Chromosoma. 1978;66: 361–388.
- View Article
- Google Scholar
38. Howell WM, Black DA. Controlled silver staining of nucleolus organizer regions with a protective colloidal developer: a 1-step method. Experientia. 1980;36: 1014–1015. pmid:6160049
- View Article
- PubMed/NCBI
- Google Scholar
39. Sumner AT. A simple technique for demonstrating centromeric heterochromatin. Exp Cell Res. 1972;75: 304–306. pmid:4117921
- View Article
- PubMed/NCBI
- Google Scholar
40. Kirov I., Khrustaleva L., Laere K. V., Soloviev A., Meeus Sofie, Romanov D., et al. (2017). DRAWID: user-friendly java software for chromosome measurements and idiogram drawing. Comparative cytogenetics, 11(4), 747–757. pmid:29302295
- View Article
- PubMed/NCBI
- Google Scholar
41. Green DM and Sessions SK, 1991. Nomenclature for chromosomes. In: Amphibian cytogenetics and evolution (Green DM and Sessions SK, eds). San Diego: Academic Press; 431–432.
42. Bruschi DP, Busin CS, Toledo LF, Vasconcellos GA, Strussmann C, Weber LN, et al. Evaluation of the taxonomic status of populations assigned to Phyllomedusa hypochondrialis (Anura, Hylidae, Phyllomedusinae) based on molecular, chromosomal, and morphological approach. BMC Genet. 2013;14. pmid:23937545
- View Article
- PubMed/NCBI
- Google Scholar
43. Pendas AM, Moran P, Freije JP, Garcia-Vazquez E. Chromosomal mapping and nucleotide sequence of two tandem repeats of Atlantic salmon 55 rDNA. Cytogenet Cell Genet. 1994;67: 31–36. pmid:8187548
- View Article
- PubMed/NCBI
- Google Scholar
44. Sambrook J, Fritschi EF, Maniats T. Molecular Cloning: a laboratory manual. Second Edi. New York: Cold Spring Harbor Laboratory Press.; 1989.
45. Hall T. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41: 95–98.
- View Article
- Google Scholar
46. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32: 1792–1797. pmid:15034147
- View Article
- PubMed/NCBI
- Google Scholar
47. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol. 2018; 35: 1547–1549. pmid:29722887
- View Article
- PubMed/NCBI
- Google Scholar
48. Stamatakis A. RAxML Version 8: A tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies. Bioinformatics, 1312–1313, 2014. pmid:24451623
- View Article
- PubMed/NCBI
- Google Scholar
49. Pinkel D, Straume T, Gray JW. Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. Proc Natl Acad Sci U S A. 1986;83: 2934–2938. pmid:3458254
- View Article
- PubMed/NCBI
- Google Scholar
50. Guerra M. Citogenética Molecular: Protocolos Comentados. Ribeirão Preto: Sociedade Brasileira de Genética; 2012.
51. Kubat Z, Hobza R, Vyskot B, Kejnovsky E. Microsatellite accumulation on the Y chromosome in Silene latifolia. Genome. 2008;51: 350–356. pmid:18438438
- View Article
- PubMed/NCBI
- Google Scholar
52. Ernetti JR, Gazolla CB, Recco-Pimentel SM, Lucas EM, Bruschi DP. Non-random distribution of microsatellite motifs and (TTAGGG)n repeats in the monkey frog Pithecopus rusticus (Anura, Phyllomedusidae) karyotype. Genet Mol Biol. 2019;42: e20190151. pmid:31968045
- View Article
- PubMed/NCBI
- Google Scholar
53. Cholak LR, Haddad CFB, Parise-Maltempi PP (2020). Cytogenetic analysis of the genus Thoropa Cope, 1865 (Anura-Cycloramphidae) with evolutionary inferences based on repetitive DNA sequences. Genet Mol Biol, v. 43, e20190364. pmid:32648889
- View Article
- PubMed/NCBI
- Google Scholar
54. Denaro L. Karyotypes of Leptodactylidae anurans. J Herpetol. 1972;6: 71–74.
- View Article
- Google Scholar
55. Guedes JJM, de Assis CL, Novaes CM, Dergam JA, Feio RN. Filling knowledge gaps about the ‘Data Deficient’ species Zachaenus carvalhoi Izecksohn, 1983 (Anura, Cycloramphidae): an endemic frog from the Atlantic Forest of southeastern Brazil. Herpetol Notes. 2019;12: 113–204.
- View Article
- Google Scholar
56. Cazaux B, Catalan J, Veyrunes F, Douzery EJP, Britton-Davidian J. Are ribosomal DNA clusters rearrangement hotspots? A case study in the genus Mus (Rodentia, Muridae). BMC Evol Biol. BioMed Central Ltd; 2011;11: 124. pmid:21569527
- View Article
- PubMed/NCBI
- Google Scholar
57. Dover G. Molecular drive: a cohesive mode of species evolution. Nature. 1982;299: 111–117. pmid:7110332
- View Article
- PubMed/NCBI
- Google Scholar
58. Dover G. Molecular drive. Trends Genet. 2002;18: 587–589. pmid:12414190
- View Article
- PubMed/NCBI
- Google Scholar
59. Charlesworth B, Sniegowski P, Stephan W. The evolutionary dynamics of repetitive DNA. Nature. 1994;371: 215–371. pmid:8078581
- View Article
- PubMed/NCBI
- Google Scholar
60. Vittorazzi SE, Lourenço LB, Solé M, Faria RG, Recco-Pimentel SM. Chromosomal analysis of Physalaemus kroyeri and Physalaemus cicada (Anura, Leptodactylidae). Comp Cytogenet. 2016;10: 311–323. pmid:27551351
- View Article
- PubMed/NCBI
- Google Scholar
61. Kuhn GCS, Küttler H, Moreira-Filho O, Heslop-Harrison JS. The 1.688 repetitive DNA of Drosophila: Concerted evolution at different genomic scales and association with genes. Mol Biol Evol. 2012;29: 7–11. pmid:21712468
- View Article
- PubMed/NCBI
- Google Scholar
62. Feliciello I, Akrap I, Brajković J, Zlatar I, Ugarković Đ. Satellite DNA as a Driver of Population Divergence in the Red Flour Beetle Tribolium castaneum. Genome Biol Evol. 2015;7: 228–239.
- View Article
- Google Scholar
63. Feliciello I, Akrap I, Ugarković Đ. Satellite DNA modulates gene expression in the beetle Tribolium castaneum after heat stress. PLOS Genet. 2015;11: e1005466. pmid:26275223
- View Article
- PubMed/NCBI
- Google Scholar
64. Nascimento J, Quinderé YRSD, Recco-Pimentel SM, Lima JRF, Lourenço LB. Heteromorphic Z and W sex chromosomes in Physalaemus ephippifer (Steindachner, 1864) (Anura, Leiuperidae). Genetica. 2010;138: 1127–1132. pmid:20882322
- View Article
- PubMed/NCBI
- Google Scholar
65. Rodrigues D, Rivera M, Lourenço L. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae). BMC Genet. 2012;13: 17. pmid:22433220
- View Article
- PubMed/NCBI
- Google Scholar
66. Martins C, Galetti PM. Two 5S rDNA arrays in Neotropical fish species: Is it a general rule for fishes? Genetica. 2001;111: 439–446. pmid:11841188
- View Article
- PubMed/NCBI
- Google Scholar
67. Pasolini P, Costagliola D, Rocco L, Tinti F. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers. J Mol Evol. 2006;62: 564–574. pmid:16612546
- View Article
- PubMed/NCBI
- Google Scholar
68. Peterson RC, Doering JL, Brown DD. Characterization of two Xenopus somatic 5S DNAs and one minor oocyte-specific 5S DNA. Cell. 1980;20: 131–141. pmid:6248230
- View Article
- PubMed/NCBI
- Google Scholar
69. Schmid M, Steinlein C. Chromosome banding in Amphibia. XXXII. The genus Xenopus (Anura, Pipidae). Cytogenet Genome Res. 2015;145: 201–217. pmid:26112092
- View Article
- PubMed/NCBI
- Google Scholar
70. Martins C, Wasko AP, Oliveira C, Porto-Foresti F, Parise-Maltempi PP, Wright JM, et al. Dynamics of 5S rDNA in the tilapia (Oreochromis niloticus) genome: repeat units, inverted sequences, pseudogenes and chromosome loci. Cytogenet Genome Res. 2002;98: 78–85. pmid:12584446
- View Article
- PubMed/NCBI
- Google Scholar
71. Merlo MA, Cross I, Manchado M, Cárdenas S, Rebordinos L. The 5S rDNA high dynamism in Diplodus sargus is a transposon-mediated mechanism. Comparison with other multigene families and Sparidae species. J Mol Evol. 2013;76: 83–97. pmid:23355010
- View Article
- PubMed/NCBI
- Google Scholar
72. Fedoriw AM, Starmer J, Yee D, Magnuson T. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals. PLoS Genet. 2012;8: e1002468. pmid:22275877
- View Article
- PubMed/NCBI
- Google Scholar
73. Frederiksen S, Cao H, Lomholt B, Levan G, Hallenberg C. The rat 5S rRNA bona fide gene repeat maps to chromosome 19q12qter and the pseudogene repeat maps to 12q12. Cytogenet Cell Genet. 1997;76: 101–106. pmid:9154136
- View Article
- PubMed/NCBI
- Google Scholar
74. Martins C, Ferreira IA, Oliveira C, Foresti F, Galetti PM. A tandemly repetitive centromeric DNA sequence of the fish Hoplias malabaricus (Characiformes: Erythrinidae) is derived from 5S rDNA. Genetica. 2006;127: 133–141. pmid:16850219
- View Article
- PubMed/NCBI
- Google Scholar
75. Kumke K, Macas J, Fuchs J, Altschmied L, Kour J, Dhar MK, et al. Plantago lagopus B chromosome is enriched in 5S rDNA-derived satellite DNA. Cytogenet Genome Res. 2016;148: 68–73. pmid:27173804
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Frost DR. Amphibian Species of the World 6.0: An Online Reference [Internet]. 2020 [cited 26 Jun 2020]. http://research.amnh.org/herpetology/amphibia/index.php

[ref2] 2. Heyer WR, Segalla M V, Silvano D, Verdade VK. Cycloramphus bolitoglossus. The IUCN Red List of Threatened Species. 2004. dx.doi.org/10.2305/IUCN.UK.2004.RLTS.T56359A11452397.en

[ref3] 3. Heyer WR, Rand AS, Cruz CAG, Peixoto OL. Decimations, extinctions, and colonizations of frog population in Southeast Brazil and their evolutionary implications. Biotropica. 1988;20: 230–235.
View Article
Google Scholar

[4] View Article

[5] Google Scholar

[ref4] 4. ICMBio. Lista Vermelha das Espécies Ameaçadas [Internet]. Brasilia; 2018. https://www.icmbio.gov.br/portal/images/stories/comunicacao/publicacoes/publicacoes-diversas/livro_vermelho_2018_vol1.pdf

[ref5] 5. Silva APZ, Haddad CFB, Kasahara S. Cytogenetic analysis of Cycloramphus boraceiensis Heyer (Anura, Leptodactylidae). Rev Bras Zool. 2001;18: 111–115.
View Article
Google Scholar

[8] View Article

[9] Google Scholar

[ref6] 6. Beçak ML, Denaro L, Beçak W. Polyploid and mechanisms of karyotypic diversification in Amphibia. Cytogenetics. 1970;9: 225–238. pmid:5474808
View Article
PubMed/NCBI
Google Scholar

[11] View Article

[12] PubMed/NCBI

[13] Google Scholar

[ref7] 7. Noleto RB, Amaro RC, Verdade VK, Campos JRC, Gallego LFK, de Lima AMX, et al. Comparative cytogenetics of eight species of Cycloramphus (Anura, Cycloramphidae). Zool Anz. 2011;250: 205–214.
View Article
Google Scholar

[15] View Article

[16] Google Scholar

[ref8] 8. Lima AMX, Garey M V, Noleto RB, Verdade VK. Natural History of the Lutz’s Frog Cycloramphus lutzorum Heyer, 1983 (Anura: Cycloramphidae) in the Brazilian Atlantic Forest: Description of the Advertisement Call, Tadpole, and Karyotype. J Herpetol. 2010;44: 360–371.
View Article
Google Scholar

[18] View Article

[19] Google Scholar

[ref9] 9. de Sá FP, Haddad CFB, Gray MM, Verdade VK, Thomé MTC, Rodrigues MT, et al. Male-male competition and repeated evolution of terrestrial breeding in Atlantic Coastal Forest frogs. Evolution (N Y). 2020;74: 459–475. pmid:31710098
View Article
PubMed/NCBI
Google Scholar

[21] View Article

[22] PubMed/NCBI

[23] Google Scholar

[ref10] 10. Targueta CP, Vittorazzi SE, Gatto KP, Bruschi DP, Veiga-Menoncello ACP, Recco-Pimentel SM, et al. Anuran Cytogenetics: an overview. In: Norris N, Miller C, editors. An Essential Guide to Cytogenetics. New York, NY: Nova Science Publishers, Inc; 2018. pp. 1–64.

[ref11] 11. Long EO, Dawid IB. Repeated Genes in Eukaryotes. Annu Rev Biochem. 1980;49: 727–764. pmid:6996571
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref12] 12. Martins C, Wasko AP. Organization and Evolution of 5S Ribosomal DNA in the Fish Genome. In: Williams CR, editor. Focus on Genome Research. Hauppauge: Nova Science Publishers, Inc; 2004. pp. 335–363.

[ref13] 13. Vierna J, Wehner S, Höner zu Siederdissen C, Martínez-Lage A, Marz M. Systematic analysis and evolution of 5S ribosomal DNA in metazoans. Heredity (Edinb). 2013;111: 410–421. pmid:23838690
View Article
PubMed/NCBI
Google Scholar

[31] View Article

[32] PubMed/NCBI

[33] Google Scholar

[ref14] 14. López-Flores I, Garrido-Ramos MA. The Repetitive DNA Content of Eukaryotic Genomes. In: Garrido-Ramos MA, editor. Genome Dynamics Repetitive DNA. Basel: Karger; 2012. pp. 1–28.

[ref15] 15. Bardella VB, Cabral-de-Mello DC. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera). Gene. 2018;646: 153–158. pmid:29253608
View Article
PubMed/NCBI
Google Scholar

[36] View Article

[37] PubMed/NCBI

[38] Google Scholar

[ref16] 16. Dimarco E, Cascone E, Bellavia D, Caradonna F. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus. Gene. 2012;508: 21–25. pmid:22967708
View Article
PubMed/NCBI
Google Scholar

[40] View Article

[41] PubMed/NCBI

[42] Google Scholar

[ref17] 17. Rebordinos L, Cross I, Merlo A. High evolutionary dynamism in 5S rDNA of fish: state of the art. Cytogenet Genome Res. 2013;141: 103–113. pmid:24080995
View Article
PubMed/NCBI
Google Scholar

[44] View Article

[45] PubMed/NCBI

[46] Google Scholar

[ref18] 18. Eirín-López JM, Rebordinos L, Rooney AP, Rozas J. The Birth-and-Death Evolution of Multigene Families Revisited. In: Garrido-Ramos MA, editor. Genome Dynamics. 7th ed. Basel: Karger Publishers; 2012. pp. 170–196. https://doi.org/10.1159/000337119 pmid:22759819

[ref19] 19. Nei M, Rooney AP. Concerted and Birth-and-Death Evolution of Multigene Families. Annu Rev Genet. 2005;39: 121–152. pmid:16285855
View Article
PubMed/NCBI
Google Scholar

[49] View Article

[50] PubMed/NCBI

[51] Google Scholar

[ref20] 20. Freire R, Arias A, Ínsua AM, Méndez J, Eirín-López JM. Evolutionary dynamics of the 5S rDNA gene family in the mussel mytilus: mixed effects of birth-and-death and concerted evolution. J Mol Evol. 2010;70: 413–426. pmid:20386892
View Article
PubMed/NCBI
Google Scholar

[53] View Article

[54] PubMed/NCBI

[55] Google Scholar

[ref21] 21. Pinhal D, Yoshimura TS, Araki CS, Martins C. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays. BMC Evol Biol. 2011;11: 151. pmid:21627815
View Article
PubMed/NCBI
Google Scholar

[57] View Article

[58] PubMed/NCBI

[59] Google Scholar

[ref22] 22. Vittorazzi SE, Lourenço LB, Del-Grande ML, Recco-Pimentel SM. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae). Cytogenet Genome Res. 2011;134: 101–107. pmid:21464559
View Article
PubMed/NCBI
Google Scholar

[61] View Article

[62] PubMed/NCBI

[63] Google Scholar

[ref23] 23. Vittorazzi SE, Lourenço LB, Recco-Pimentel SM. Long-time evolution and highly dynamic satellite DNA in leptodactylid and hylodid frogs. BMC Genet. 2014;15: 111. pmid:25316286
View Article
PubMed/NCBI
Google Scholar

[65] View Article

[66] PubMed/NCBI

[67] Google Scholar

[ref24] 24. Gatto KP, Busin CS, Lourenço LB. Unraveling the sex chromosome heteromorphism of the paradoxical frog Pseudis tocantins. PLoS One. 2016;11: e0156176. pmid:27214234
View Article
PubMed/NCBI
Google Scholar

[69] View Article

[70] PubMed/NCBI

[71] Google Scholar

[ref25] 25. Gatto KP, Mattos J V, Seger KR, Lourenço LB. Sex chromosome differentiation in the frog genus Pseudis involves satellite DNA and chromosome rearrangements. Front Genet. 2018;9: 301. pmid:30147705
View Article
PubMed/NCBI
Google Scholar

[73] View Article

[74] PubMed/NCBI

[75] Google Scholar

[ref26] 26. Gatto K, Seger K, Garcia P, Lourenço L. Satellite DNA Mapping in Pseudis fusca (Hylidae, Pseudinae) Provides New Insights into Sex Chromosome Evolution in Paradoxical Frogs. Genes (Basel). 2019;10: 160. pmid:30791490
View Article
PubMed/NCBI
Google Scholar

[77] View Article

[78] PubMed/NCBI

[79] Google Scholar

[ref27] 27. Da Silva M. J., Fogarin Destro R., Gazoni T., Narimatsu H., Pereira dos Santos P. S., Haddad C. F. B., et al. (2020). Great Abundance of Satellite DNA in Proceratophrys (Anura, Odontophrynidae) Revealed by Genome Sequencing. Cytogenetic and Genome Research. pmid:32146462
View Article
PubMed/NCBI
Google Scholar

[81] View Article

[82] PubMed/NCBI

[83] Google Scholar

[ref28] 28. Chistiakov DA, Hellemans B, Volckaert FAM. Microsatellites and their genomic distribution, evolution, function and applications: A review with special reference to fish genetics. Aquaculture. 2006;255: 1–29.
View Article
Google Scholar

[85] View Article

[86] Google Scholar

[ref29] 29. Guo WJ, Ling J, Li P. Consensus features of microsatellite distribution: Microsatellite contents are universally correlated with recombination rates and are preferentially depressed by centromeres in multicellular eukaryotic genomes. Genomics. 2009;93: 323–331. pmid:19146945
View Article
PubMed/NCBI
Google Scholar

[88] View Article

[89] PubMed/NCBI

[90] Google Scholar

[ref30] 30. Tóth G, Gáspári Z, Jurka J. Microsatellites in different eukaryotic genomes: Surveys and analysis. Genome Res. Cold Spring Harbor Laboratory Press; 2000;10: 967–981. pmid:10899146
View Article
PubMed/NCBI
Google Scholar

[92] View Article

[93] PubMed/NCBI

[94] Google Scholar

[ref31] 31. Travenzoli NM, Lima BA, Cardoso DC, Dergam JA, Fernandes-Salomão TM, Lopes DM. Cytogenetic Analysis and Chromosomal Mapping of Repetitive DNA in Melipona Species (Hymenoptera, Meliponini). Cytogenet Genome Res. S. Karger AG; 2019;158: 213–224.
View Article
Google Scholar

[96] View Article

[97] Google Scholar

[ref32] 32. Sassi Oliveira, Bertollo Nirchio, Hatanaka Marinho, et al. Chromosomal Evolution and Evolutionary Relationships of Lebiasina Species (Characiformes, Lebiasinidae). Int J Mol Sci.; 2019;20: 2944. pmid:31208145
View Article
PubMed/NCBI
Google Scholar

[99] View Article

[100] PubMed/NCBI

[101] Google Scholar

[ref33] 33. Scacchetti PC, Utsunomia R, Pansonato-Alves JC, Vicari MR, Artoni RF, Oliveira C, et al. Chromosomal mapping of repetitive DNAs in Characidium (Teleostei, Characiformes): genomic organization and diversification of ZW sex chromosomes. Cytogenet Genome Res. 2015;146: 136–143. pmid:26277929
View Article
PubMed/NCBI
Google Scholar

[103] View Article

[104] PubMed/NCBI

[105] Google Scholar

[ref34] 34. Ruiz-Ruano FJ, Cuadrado Á, Montiel EE, Camacho JPM, López-León MD. Next generation sequencing and FISH reveal uneven and nonrandom microsatellite distribution in two grasshopper genomes. Chromosoma. 2015;124: 221–234. pmid:25387401
View Article
PubMed/NCBI
Google Scholar

[107] View Article

[108] PubMed/NCBI

[109] Google Scholar

[ref35] 35. Pucci MB, Barbosa P, Nogaroto V, Almeida MC, Artoni RF, Scacchetti PC, et al. Chromosomal spreading of microsatellites and (TTAGGG) sequences in the Characidium zebra and C. gomesi genomes (Characiformes: Crenuchidae). Cytogenet Genome Res. 2016;149: 182–190. pmid:27504623
View Article
PubMed/NCBI
Google Scholar

[111] View Article

[112] PubMed/NCBI

[113] Google Scholar

[ref36] 36. King M, Rofe R. Karyotypic variation in the Australian gekko Phyllodactylus marmoratus (Gray) (Gekkonidae: Reptilia). Chromosoma. 1976;54: 75–87. pmid:1248335
View Article
PubMed/NCBI
Google Scholar

[115] View Article

[116] PubMed/NCBI

[117] Google Scholar

[ref37] 37. Schmid M. Chromosome banding in Amphibia. I. Constitutive heterochromatin and nucleolus organizer regions in Bufo and Hyla. Chromosoma. 1978;66: 361–388.
View Article
Google Scholar

[119] View Article

[120] Google Scholar

[ref38] 38. Howell WM, Black DA. Controlled silver staining of nucleolus organizer regions with a protective colloidal developer: a 1-step method. Experientia. 1980;36: 1014–1015. pmid:6160049
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref39] 39. Sumner AT. A simple technique for demonstrating centromeric heterochromatin. Exp Cell Res. 1972;75: 304–306. pmid:4117921
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref40] 40. Kirov I., Khrustaleva L., Laere K. V., Soloviev A., Meeus Sofie, Romanov D., et al. (2017). DRAWID: user-friendly java software for chromosome measurements and idiogram drawing. Comparative cytogenetics, 11(4), 747–757. pmid:29302295
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref41] 41. Green DM and Sessions SK, 1991. Nomenclature for chromosomes. In: Amphibian cytogenetics and evolution (Green DM and Sessions SK, eds). San Diego: Academic Press; 431–432.

[ref42] 42. Bruschi DP, Busin CS, Toledo LF, Vasconcellos GA, Strussmann C, Weber LN, et al. Evaluation of the taxonomic status of populations assigned to Phyllomedusa hypochondrialis (Anura, Hylidae, Phyllomedusinae) based on molecular, chromosomal, and morphological approach. BMC Genet. 2013;14. pmid:23937545
View Article
PubMed/NCBI
Google Scholar

[135] View Article

[136] PubMed/NCBI

[137] Google Scholar

[ref43] 43. Pendas AM, Moran P, Freije JP, Garcia-Vazquez E. Chromosomal mapping and nucleotide sequence of two tandem repeats of Atlantic salmon 55 rDNA. Cytogenet Cell Genet. 1994;67: 31–36. pmid:8187548
View Article
PubMed/NCBI
Google Scholar

[139] View Article

[140] PubMed/NCBI

[141] Google Scholar

[ref44] 44. Sambrook J, Fritschi EF, Maniats T. Molecular Cloning: a laboratory manual. Second Edi. New York: Cold Spring Harbor Laboratory Press.; 1989.

[ref45] 45. Hall T. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41: 95–98.
View Article
Google Scholar

[144] View Article

[145] Google Scholar

[ref46] 46. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32: 1792–1797. pmid:15034147
View Article
PubMed/NCBI
Google Scholar

[147] View Article

[148] PubMed/NCBI

[149] Google Scholar

[ref47] 47. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol. 2018; 35: 1547–1549. pmid:29722887
View Article
PubMed/NCBI
Google Scholar

[151] View Article

[152] PubMed/NCBI

[153] Google Scholar

[ref48] 48. Stamatakis A. RAxML Version 8: A tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies. Bioinformatics, 1312–1313, 2014. pmid:24451623
View Article
PubMed/NCBI
Google Scholar

[155] View Article

[156] PubMed/NCBI

[157] Google Scholar

[ref49] 49. Pinkel D, Straume T, Gray JW. Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. Proc Natl Acad Sci U S A. 1986;83: 2934–2938. pmid:3458254
View Article
PubMed/NCBI
Google Scholar

[159] View Article

[160] PubMed/NCBI

[161] Google Scholar

[ref50] 50. Guerra M. Citogenética Molecular: Protocolos Comentados. Ribeirão Preto: Sociedade Brasileira de Genética; 2012.

[ref51] 51. Kubat Z, Hobza R, Vyskot B, Kejnovsky E. Microsatellite accumulation on the Y chromosome in Silene latifolia. Genome. 2008;51: 350–356. pmid:18438438
View Article
PubMed/NCBI
Google Scholar

[164] View Article

[165] PubMed/NCBI

[166] Google Scholar

[ref52] 52. Ernetti JR, Gazolla CB, Recco-Pimentel SM, Lucas EM, Bruschi DP. Non-random distribution of microsatellite motifs and (TTAGGG)n repeats in the monkey frog Pithecopus rusticus (Anura, Phyllomedusidae) karyotype. Genet Mol Biol. 2019;42: e20190151. pmid:31968045
View Article
PubMed/NCBI
Google Scholar

[168] View Article

[169] PubMed/NCBI

[170] Google Scholar

[ref53] 53. Cholak LR, Haddad CFB, Parise-Maltempi PP (2020). Cytogenetic analysis of the genus Thoropa Cope, 1865 (Anura-Cycloramphidae) with evolutionary inferences based on repetitive DNA sequences. Genet Mol Biol, v. 43, e20190364. pmid:32648889
View Article
PubMed/NCBI
Google Scholar

[172] View Article

[173] PubMed/NCBI

[174] Google Scholar

[ref54] 54. Denaro L. Karyotypes of Leptodactylidae anurans. J Herpetol. 1972;6: 71–74.
View Article
Google Scholar

[176] View Article

[177] Google Scholar

[ref55] 55. Guedes JJM, de Assis CL, Novaes CM, Dergam JA, Feio RN. Filling knowledge gaps about the ‘Data Deficient’ species Zachaenus carvalhoi Izecksohn, 1983 (Anura, Cycloramphidae): an endemic frog from the Atlantic Forest of southeastern Brazil. Herpetol Notes. 2019;12: 113–204.
View Article
Google Scholar

[179] View Article

[180] Google Scholar

[ref56] 56. Cazaux B, Catalan J, Veyrunes F, Douzery EJP, Britton-Davidian J. Are ribosomal DNA clusters rearrangement hotspots? A case study in the genus Mus (Rodentia, Muridae). BMC Evol Biol. BioMed Central Ltd; 2011;11: 124. pmid:21569527
View Article
PubMed/NCBI
Google Scholar

[182] View Article

[183] PubMed/NCBI

[184] Google Scholar

[ref57] 57. Dover G. Molecular drive: a cohesive mode of species evolution. Nature. 1982;299: 111–117. pmid:7110332
View Article
PubMed/NCBI
Google Scholar

[186] View Article

[187] PubMed/NCBI

[188] Google Scholar

[ref58] 58. Dover G. Molecular drive. Trends Genet. 2002;18: 587–589. pmid:12414190
View Article
PubMed/NCBI
Google Scholar

[190] View Article

[191] PubMed/NCBI

[192] Google Scholar

[ref59] 59. Charlesworth B, Sniegowski P, Stephan W. The evolutionary dynamics of repetitive DNA. Nature. 1994;371: 215–371. pmid:8078581
View Article
PubMed/NCBI
Google Scholar

[194] View Article

[195] PubMed/NCBI

[196] Google Scholar

[ref60] 60. Vittorazzi SE, Lourenço LB, Solé M, Faria RG, Recco-Pimentel SM. Chromosomal analysis of Physalaemus kroyeri and Physalaemus cicada (Anura, Leptodactylidae). Comp Cytogenet. 2016;10: 311–323. pmid:27551351
View Article
PubMed/NCBI
Google Scholar

[198] View Article

[199] PubMed/NCBI

[200] Google Scholar

[ref61] 61. Kuhn GCS, Küttler H, Moreira-Filho O, Heslop-Harrison JS. The 1.688 repetitive DNA of Drosophila: Concerted evolution at different genomic scales and association with genes. Mol Biol Evol. 2012;29: 7–11. pmid:21712468
View Article
PubMed/NCBI
Google Scholar

[202] View Article

[203] PubMed/NCBI

[204] Google Scholar

[ref62] 62. Feliciello I, Akrap I, Brajković J, Zlatar I, Ugarković Đ. Satellite DNA as a Driver of Population Divergence in the Red Flour Beetle Tribolium castaneum. Genome Biol Evol. 2015;7: 228–239.
View Article
Google Scholar

[206] View Article

[207] Google Scholar

[ref63] 63. Feliciello I, Akrap I, Ugarković Đ. Satellite DNA modulates gene expression in the beetle Tribolium castaneum after heat stress. PLOS Genet. 2015;11: e1005466. pmid:26275223
View Article
PubMed/NCBI
Google Scholar

[209] View Article

[210] PubMed/NCBI

[211] Google Scholar

[ref64] 64. Nascimento J, Quinderé YRSD, Recco-Pimentel SM, Lima JRF, Lourenço LB. Heteromorphic Z and W sex chromosomes in Physalaemus ephippifer (Steindachner, 1864) (Anura, Leiuperidae). Genetica. 2010;138: 1127–1132. pmid:20882322
View Article
PubMed/NCBI
Google Scholar

[213] View Article

[214] PubMed/NCBI

[215] Google Scholar

[ref65] 65. Rodrigues D, Rivera M, Lourenço L. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae). BMC Genet. 2012;13: 17. pmid:22433220
View Article
PubMed/NCBI
Google Scholar

[217] View Article

[218] PubMed/NCBI

[219] Google Scholar

[ref66] 66. Martins C, Galetti PM. Two 5S rDNA arrays in Neotropical fish species: Is it a general rule for fishes? Genetica. 2001;111: 439–446. pmid:11841188
View Article
PubMed/NCBI
Google Scholar

[221] View Article

[222] PubMed/NCBI

[223] Google Scholar

[ref67] 67. Pasolini P, Costagliola D, Rocco L, Tinti F. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers. J Mol Evol. 2006;62: 564–574. pmid:16612546
View Article
PubMed/NCBI
Google Scholar

[225] View Article

[226] PubMed/NCBI

[227] Google Scholar

[ref68] 68. Peterson RC, Doering JL, Brown DD. Characterization of two Xenopus somatic 5S DNAs and one minor oocyte-specific 5S DNA. Cell. 1980;20: 131–141. pmid:6248230
View Article
PubMed/NCBI
Google Scholar

[229] View Article

[230] PubMed/NCBI

[231] Google Scholar

[ref69] 69. Schmid M, Steinlein C. Chromosome banding in Amphibia. XXXII. The genus Xenopus (Anura, Pipidae). Cytogenet Genome Res. 2015;145: 201–217. pmid:26112092
View Article
PubMed/NCBI
Google Scholar

[233] View Article

[234] PubMed/NCBI

[235] Google Scholar

[ref70] 70. Martins C, Wasko AP, Oliveira C, Porto-Foresti F, Parise-Maltempi PP, Wright JM, et al. Dynamics of 5S rDNA in the tilapia (Oreochromis niloticus) genome: repeat units, inverted sequences, pseudogenes and chromosome loci. Cytogenet Genome Res. 2002;98: 78–85. pmid:12584446
View Article
PubMed/NCBI
Google Scholar

[237] View Article

[238] PubMed/NCBI

[239] Google Scholar

[ref71] 71. Merlo MA, Cross I, Manchado M, Cárdenas S, Rebordinos L. The 5S rDNA high dynamism in Diplodus sargus is a transposon-mediated mechanism. Comparison with other multigene families and Sparidae species. J Mol Evol. 2013;76: 83–97. pmid:23355010
View Article
PubMed/NCBI
Google Scholar

[241] View Article

[242] PubMed/NCBI

[243] Google Scholar

[ref72] 72. Fedoriw AM, Starmer J, Yee D, Magnuson T. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals. PLoS Genet. 2012;8: e1002468. pmid:22275877
View Article
PubMed/NCBI
Google Scholar

[245] View Article

[246] PubMed/NCBI

[247] Google Scholar

[ref73] 73. Frederiksen S, Cao H, Lomholt B, Levan G, Hallenberg C. The rat 5S rRNA bona fide gene repeat maps to chromosome 19q12qter and the pseudogene repeat maps to 12q12. Cytogenet Cell Genet. 1997;76: 101–106. pmid:9154136
View Article
PubMed/NCBI
Google Scholar

[249] View Article

[250] PubMed/NCBI

[251] Google Scholar

[ref74] 74. Martins C, Ferreira IA, Oliveira C, Foresti F, Galetti PM. A tandemly repetitive centromeric DNA sequence of the fish Hoplias malabaricus (Characiformes: Erythrinidae) is derived from 5S rDNA. Genetica. 2006;127: 133–141. pmid:16850219
View Article
PubMed/NCBI
Google Scholar

[253] View Article

[254] PubMed/NCBI

[255] Google Scholar

[ref75] 75. Kumke K, Macas J, Fuchs J, Altschmied L, Kour J, Dhar MK, et al. Plantago lagopus B chromosome is enriched in 5S rDNA-derived satellite DNA. Cytogenet Genome Res. 2016;148: 68–73. pmid:27173804
View Article
PubMed/NCBI
Google Scholar

[257] View Article

[258] PubMed/NCBI

[259] Google Scholar

Figures

Abstract

Introduction

Materials and methods

Biological samples and classical cytogenetic analysis

Isolation of the 5S rDNA and PcP190, cloning, and molecular characterization

Fluorescent in situ hybridization assays (FISH)

Results

Description of the karyotype and the chromosomal mapping of the microsatellites and telomeric repeats

Molecular analysis of the 5S rDNA of Cycloramphus bolitoglossus

PcP190 satDNA identification reveals chromosome spreading in the C. bolitoglossus karyotype

Discussion

Insights into the evolution of the Cycloramphus species chromosomes

Recurrent association between satDNA PcP190 and rDNA 5S in the Anura: Additional evidence

Conclusions

Supporting information

S1 Table. 5S rDNA accession numbers.

S2 Table. PcP190 satDNA accession numbers.

S3 Table. Chromosome measurements.

S4 Table. PcP190 SatDNA genetic similarity.

Acknowledgments

References